Campbell Biology: Custom Edition
18th Edition
ISBN: 9781323717271
Author: Urry, Cain, Wasserman, Minorsky, Reece
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17.2, Problem 2CC
What enables RNA polymerase to start transcribing a gene at the right place on the DNA in a bacterial cell?
In a eukaryotic cell?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A certain template DNA strand has the following nucleotide sequence:
3’-TACTCGATGCTGTGCGAT-5’
a) What would be the nucleotide sequence of the complementary nontemplate DNA strand? What is this process called and where does this occur in the eukaryotic cell?
b) Take the template strand through the process of transcription. What is the resulting strand called and where does this process occur in a eukaryotic cell.
c) Take the template strand through the process of translation including the location in the cell. You should finish with a polypeptide chain. You will need to use the Genetic code found in your notes/book
The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA as a template strand for transcription, you are required to synthesize a new RNA strand. A) Show the codons that will be present on the RNA strand. B) Using the universal genetic code, provide the amino acids on the protein that will be translated from the RNA strand.
3’ TAC ATG GTT GTG CTA ATT 5’
Why is the genome contained within a membrane?
Chapter 17 Solutions
Campbell Biology: Custom Edition
Ch. 17.1 - Prob. 1CCCh. 17.1 - What polypeptide product would you expect from a...Ch. 17.1 - Prob. 3CCCh. 17.2 - MAKE CONNECTIONS In a research artide about...Ch. 17.2 - What enables RNA polymerase to start transcribing...Ch. 17.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 17.3 - There are about 20,000 human protein-coding genes....Ch. 17.3 - How is RNA splicing similar to how you would watch...Ch. 17.3 - Prob. 3CCCh. 17.4 - What two processes ensure that the correct amino...
Ch. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - WH AT IF? In eukaryotic cells, mRNAs have been...Ch. 17.5 - What happens when one nucleotide pair is lost from...Ch. 17.5 - MAKE CONNECTIONS Individuals heterozygous for the...Ch. 17.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 17 - Describe the process of gene expression, by which...Ch. 17 - What are the similarities and differences in the...Ch. 17 - What function do the 5' cap and the poly-A tail...Ch. 17 - Prob. 17.4CRCh. 17 - What will be the results of chemically modifying...Ch. 17 - In eukaryotic cells, transcription cannot begin...Ch. 17 - Which of the following is not true of a codon? (A)...Ch. 17 - The anticodon of a particular tRNA molecule is (A)...Ch. 17 - Which of the following is not true of RNA...Ch. 17 - Which component is not directly involved in...Ch. 17 - Using Figure 17.6, identify a 5' 3' sequence of...Ch. 17 - Prob. 7TYUCh. 17 - Would the coupling of the processes shown in...Ch. 17 - Prob. 9TYUCh. 17 - Prob. 10TYUCh. 17 - scientific inquiry Knowing that the genetic code...Ch. 17 - Prob. 12TYUCh. 17 - Prob. 13TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes
1. Rub your hands together vigorously. What happens? Discuss the energy transfers and transformations that take...
College Physics: A Strategic Approach (3rd Edition)
45. Calculate the mass of nitrogen dissolved at room temperature in an 80.0-L home aquarium. Assume a total pre...
Chemistry: Structure and Properties (2nd Edition)
Single penny tossed 20 times and counting heads and tails: Probability (prediction): _______/20 heads ________/...
Laboratory Manual For Human Anatomy & Physiology
How does the removal of hydrogen atoms from nutrient molecules result in a loss of energy from the nutrient mol...
SEELEY'S ANATOMY+PHYSIOLOGY
4. 38 Strontium has four naturally occurring isotopes, with mass numbers 84, 86, 87, arid 88.
a. Write the atom...
General, Organic, and Biological Chemistry: Structures of Life (5th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Process by which the DNA sequences encoding exons are exchanged and reordered through genetic recombination between DNA sequences encoding introns. Group of answer choices a)RNA editing b)Exon Definition c) Exon Shuffling d)Transesterificationarrow_forwardThe double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical protein. The strand on top reads 5' to 3* left to right, while the strand on the bottom reads 5' to 3' right to left. The nucleotides are numbered 1 to 100. REMINDER: For this problem, transcription begins with and includes the red and underlined C/G (top strand/bottom strand) base pair and RNA polymerase proceeds from left to right along the DNA. 1 20 40 5'-GTGTCCGTCTAATATTGTGAGATGTTATATCCCGCCGTCAACACCATCAA-3' ------+ 3'-САСAGGCAGATTATAACAСТСТАСААТАТAGGGCGGCAGTTСTGGTAGTT-5* 60 80 100 5'-ACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC-3' -------+ 3'-TGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG-5' 1. What are the nucleotides of the resulting MRNA? Indicate the 5' and 3' ends of the MRNA. 2. What are the amino acids translated from the resulting MRNA? 3. Do the underlined nucleotides TAA (indicated in blue) encode a stop codon for the protein? Briefly explain your answer.arrow_forwardRNA polymerases Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a) need a primer a b b) synthesize RNA 5' to 3' c) never make any mistakes C d) none of the abovearrow_forward
- 26) Eukaryotes are unable to couple transcription and translation because: A) the two processes occur in separate regions of the cell B) they do not have the specialized ribosomes that occur in bacteria C) the genetic code in eukaryotes is incompatible with the formation of polyribosomes D) the mRNA of eukaryotes do not have the appropriate spacers that polycistrons allow for polyribosomes to form E) eukaryotic mRNA molecules are monocistronic. asap please.arrow_forwardWhat are the major subunits of a bacterial RNA polymerase? list all of themarrow_forwardThe -35 and -10 consensus sequences upstream from the transcription start site are A) O located in the mRNA transeript. B) Oused for ribosome binding C) O needed for rolling circle replication D) O where the start codon for translation is located E) O None of the above is correctarrow_forward
- If the following piece of DNA were used as a template for transcription, what would the sequence of the new RNA strand be? Template: 5'-GACATAGAA-3' 5'-UUCUAUGUC-3' 5-TTСТАТGTС-3' 5'-CUGUAUCUU-3' 5-СTGTATСTT-3arrow_forwardGiven the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'arrow_forwardThe following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. Draw or write-out a) the sequence of the primary transcript and b) the mature mRNA resulting from this stretch of DNA.arrow_forward
- Which is the coding strand? Which is the template strand? What is the direction of mRNA transcription by RNA-Polymerase for this gene?arrow_forwardEukaryotic cells contain O a) 5 nuclear RNA polymerases b) 3 nuclear RNA polymerases O c) 6 nuclear RNA polymerases O d) none of these is true that transcribe distinct classes of genes.arrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license