Campbell Biology: Custom Edition
18th Edition
ISBN: 9781323717271
Author: Urry, Cain, Wasserman, Minorsky, Reece
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17, Problem 11TYU
scientific inquiry Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (shown in Figure 17.12) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Analyse and interpret the SCAM data in Fig. 1, and make a table (remember to include a legend) to indicate where each amino acid is located (cytoplasm, membrane, periplasm).
None
Give only typing answer with explanation and conclusion
Chapter 17 Solutions
Campbell Biology: Custom Edition
Ch. 17.1 - Prob. 1CCCh. 17.1 - What polypeptide product would you expect from a...Ch. 17.1 - Prob. 3CCCh. 17.2 - MAKE CONNECTIONS In a research artide about...Ch. 17.2 - What enables RNA polymerase to start transcribing...Ch. 17.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 17.3 - There are about 20,000 human protein-coding genes....Ch. 17.3 - How is RNA splicing similar to how you would watch...Ch. 17.3 - Prob. 3CCCh. 17.4 - What two processes ensure that the correct amino...
Ch. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - WH AT IF? In eukaryotic cells, mRNAs have been...Ch. 17.5 - What happens when one nucleotide pair is lost from...Ch. 17.5 - MAKE CONNECTIONS Individuals heterozygous for the...Ch. 17.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 17 - Describe the process of gene expression, by which...Ch. 17 - What are the similarities and differences in the...Ch. 17 - What function do the 5' cap and the poly-A tail...Ch. 17 - Prob. 17.4CRCh. 17 - What will be the results of chemically modifying...Ch. 17 - In eukaryotic cells, transcription cannot begin...Ch. 17 - Which of the following is not true of a codon? (A)...Ch. 17 - The anticodon of a particular tRNA molecule is (A)...Ch. 17 - Which of the following is not true of RNA...Ch. 17 - Which component is not directly involved in...Ch. 17 - Using Figure 17.6, identify a 5' 3' sequence of...Ch. 17 - Prob. 7TYUCh. 17 - Would the coupling of the processes shown in...Ch. 17 - Prob. 9TYUCh. 17 - Prob. 10TYUCh. 17 - scientific inquiry Knowing that the genetic code...Ch. 17 - Prob. 12TYUCh. 17 - Prob. 13TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forwardHi, Can someone solve this question, what are the steps of translation in order based on when they occur? It would be nice if some solved itarrow_forward. The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution muta- tions (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons. (a) How many total mutations are possible? (b) How many of these mutations are "silent," in the sense that the mutant codon is changed to another Arg codon? (c) How many of these mutations are conservative, in the sense that an Arg codon is changed to a functionally similar Lys codon?arrow_forward
- Give typing answer with explanation and conclusionarrow_forward10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence anarrow_forwardMatch each of the following examples with the hypothesis it argues against. Example The gene coding for keratin A gene coding for a tRNA Three genes, each coding for one of the G protein subunits (a, ß and y) A gene that undergoes alternative splicing Hypothesis One gene → one polypeptide One gene→→ one enzyme One gene → one protein One gene → one proteinarrow_forward
- Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.arrow_forwardExplain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'arrow_forwardSickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…arrow_forward
- Once translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?arrow_forwardIn regard to the wobble hypothesis and the fact that cells do not need a full complement of tRNAs for codons. What would the consequences be if a cell lost the tRNA gene with the following anticodon sequences Please explain in depth A. 3'-ACA-5' B. 3'-CUG-5'arrow_forwardDNA 5' ATGGCTTCTCAATACTGCTTTGTTTTGGTT 3' template strand 3' TACCGAAGAGTTATGACGAAACAAAACCAA 5' coding strand Write down the sequence of nucleotides in a fragment of an m-RNA molecule that will be produced based on the information in the DNA fragment above (start with 5' and end with 3'). If you separate codons in MRNA with blank spaces, it will be easier to do the next step. MRNA: 5' Using a three-letter code for amino acids write the sequence of the first ten amino acids of the protein pectate lyase (refer to the table of 64 codons from a lecture or a textbook).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology - Intro to Cell Structure - Quick Review!; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=vwAJ8ByQH2U;License: Standard youtube license