
Foundations in Microbiology
9th Edition
ISBN: 9780073522609
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 16.6, Problem 21ELO
Summary Introduction
To determine:
The pathology of autoimmune diseases.
Introduction:
Autoimmunity is the mechanism in which the immune system of an individual fails to differentiate between the foreign cells and its own cells and develops hypersensitivity against its healthy cells and tissues. Any disease that occurs due to this abnormal immune response is regarded as an autoimmune disease.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 16 Solutions
Foundations in Microbiology
Ch. 16.1 - Summarize the main categories of immunopathology...Ch. 16.1 - Prob. 2ELOCh. 16.1 - Explain what is meant by immunopathology and give...Ch. 16.1 - Prob. 2CYPCh. 16.1 - What is involved in the four categories of B-cell...Ch. 16.1 - What does it mean for a reaction to be immediate...Ch. 16.2 - Describe general characteristics of allergic...Ch. 16.2 - Prob. 4ELOCh. 16.2 - Prob. 5ELOCh. 16.2 - Prob. 6ELO
Ch. 16.2 - Prob. 7ELOCh. 16.2 - Prob. 8ELOCh. 16.2 - Prob. 9ELOCh. 16.2 - Prob. 5CYPCh. 16.2 - Describe several factors that influence types and...Ch. 16.2 - Prob. 7CYPCh. 16.2 - Prob. 8CYPCh. 16.2 - Prob. 9CYPCh. 16.2 - Prob. 10CYPCh. 16.2 - Outline the target organs and symptoms of the...Ch. 16.2 - Prob. 12CYPCh. 16.3 - Prob. 10ELOCh. 16.3 - Define what is meant by blood groups, explain how...Ch. 16.3 - Prob. 12ELOCh. 16.3 - Prob. 13ELOCh. 16.3 - Prob. 13CYPCh. 16.3 - Explain why the tissues of some people are...Ch. 16.3 - Prob. 15CYPCh. 16.3 - Where do we derive our natural hypersensitivities...Ch. 16.3 - Prob. 17CYPCh. 16.3 - Prob. 18CYPCh. 16.3 - Prob. 19CYPCh. 16.4 - Describe the background features of immune complex...Ch. 16.4 - Prob. 15ELOCh. 16.4 - Contrast type II and type III hypersensitivities...Ch. 16.4 - Explain what occurs in immune complex diseases and...Ch. 16.5 - Prob. 16ELOCh. 16.5 - Prob. 17ELOCh. 16.5 - Prob. 18ELOCh. 16.5 - Discuss the involvement of T cells in organ...Ch. 16.5 - Describe the categories of grafts and how...Ch. 16.5 - Prob. 22CYPCh. 16.5 - Prob. 23CYPCh. 16.5 - What does it mean to say that tissues from two...Ch. 16.5 - Prob. 25CYPCh. 16.6 - Prob. 21ELOCh. 16.6 - Explain the origins of autoimmunity and describe...Ch. 16.6 - Prob. 23ELOCh. 16.6 - Explain the pathologic process in autoimmunity.Ch. 16.6 - Prob. 27CYPCh. 16.6 - Describe four major types of autoimmunity,...Ch. 16.7 - Outline the categories of immunodeficiency...Ch. 16.7 - Prob. 25ELOCh. 16.7 - Relate examples of secondary immunodeficiencies.Ch. 16.7 - Prob. 29CYPCh. 16.7 - Prob. 30CYPCh. 16.7 - Prob. 31CYPCh. 16.7 - Define cancer, and differentiate between a benign...Ch. 16.7 - Describe the relationship between cancer and the...Ch. 16.8 - Describe the characteristics of cancer, and...Ch. 16.8 - Explain how immune function relates to the...Ch. 16.L1 - Prob. 1MCQCh. 16.L1 - Prob. 2MCQCh. 16.L1 - Which hypersensitivities are T-cell mediated? a....Ch. 16.L1 - The contact with allergen that results in symptoms...Ch. 16.L1 - Prob. 5MCQCh. 16.L1 - Prob. 6MCQCh. 16.L1 - Prob. 7MCQCh. 16.L1 - Prob. 8MCQCh. 16.L1 - Prob. 9MCQCh. 16.L1 - Prob. 10MCQCh. 16.L1 - Prob. 11MCQCh. 16.L1 - A positive tuberculin skin test is an example of...Ch. 16.L1 - Prob. 13MCQCh. 16.L1 - Prob. 14MCQCh. 16.L1 - Prob. 15MCQCh. 16.L1 - How is the immune system involved in development...Ch. 16.L1 - Pollen is which type of allergen? a. anti-a alone...Ch. 16.L1 - Prob. 2CSRCh. 16.L1 - Prob. 3CSRCh. 16.L1 - Compare and contrast atopic allerg and type IV...Ch. 16.L1 - Prob. 2WCCh. 16.L1 - Why is a hemolytic transfusion reaction considered...Ch. 16.L1 - Prob. 4WCCh. 16.L1 - Explain how people with autoimmunity could develop...Ch. 16.L2 - Suggest some possible physiological benefits of...Ch. 16.L2 - Prob. 2CTCh. 16.L2 - Why would a person be allergic to strawberries...Ch. 16.L2 - a. Where in the course of type I allergies do...Ch. 16.L2 - Although we call persons with type O blood...Ch. 16.L2 - Prob. 6CTCh. 16.L2 - Prob. 7CTCh. 16.L2 - How can a person prevent becoming allergic to...Ch. 16.L2 - Prob. 9CTCh. 16.L2 - a. Explain why babies with agammaglobulinemia do...Ch. 16.L2 - In what ways can cancer be both a cause and a...Ch. 16.L2 - Looking at figure 15.8, reproduced here, explain...Ch. 16.L2 - Prob. 2VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Immune System Diseases and Disorders; Author: Heather Davis;https://www.youtube.com/watch?v=3lIkxNv7MVI;License: Standard youtube license