
Foundations in Microbiology
9th Edition
ISBN: 9780073522609
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 16.3, Problem 13CYP
Summary Introduction
To determine:
The mechanism of type II hypersensitivity.
Introduction:
Type II hypersensitivities are characterized by complement-assisted cell lysis by developing IgG and IgM antibodies aimed against antigens. The antigens are protein molecules that stimulate immune system to develop antibodies.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 16 Solutions
Foundations in Microbiology
Ch. 16.1 - Summarize the main categories of immunopathology...Ch. 16.1 - Prob. 2ELOCh. 16.1 - Explain what is meant by immunopathology and give...Ch. 16.1 - Prob. 2CYPCh. 16.1 - What is involved in the four categories of B-cell...Ch. 16.1 - What does it mean for a reaction to be immediate...Ch. 16.2 - Describe general characteristics of allergic...Ch. 16.2 - Prob. 4ELOCh. 16.2 - Prob. 5ELOCh. 16.2 - Prob. 6ELO
Ch. 16.2 - Prob. 7ELOCh. 16.2 - Prob. 8ELOCh. 16.2 - Prob. 9ELOCh. 16.2 - Prob. 5CYPCh. 16.2 - Describe several factors that influence types and...Ch. 16.2 - Prob. 7CYPCh. 16.2 - Prob. 8CYPCh. 16.2 - Prob. 9CYPCh. 16.2 - Prob. 10CYPCh. 16.2 - Outline the target organs and symptoms of the...Ch. 16.2 - Prob. 12CYPCh. 16.3 - Prob. 10ELOCh. 16.3 - Define what is meant by blood groups, explain how...Ch. 16.3 - Prob. 12ELOCh. 16.3 - Prob. 13ELOCh. 16.3 - Prob. 13CYPCh. 16.3 - Explain why the tissues of some people are...Ch. 16.3 - Prob. 15CYPCh. 16.3 - Where do we derive our natural hypersensitivities...Ch. 16.3 - Prob. 17CYPCh. 16.3 - Prob. 18CYPCh. 16.3 - Prob. 19CYPCh. 16.4 - Describe the background features of immune complex...Ch. 16.4 - Prob. 15ELOCh. 16.4 - Contrast type II and type III hypersensitivities...Ch. 16.4 - Explain what occurs in immune complex diseases and...Ch. 16.5 - Prob. 16ELOCh. 16.5 - Prob. 17ELOCh. 16.5 - Prob. 18ELOCh. 16.5 - Discuss the involvement of T cells in organ...Ch. 16.5 - Describe the categories of grafts and how...Ch. 16.5 - Prob. 22CYPCh. 16.5 - Prob. 23CYPCh. 16.5 - What does it mean to say that tissues from two...Ch. 16.5 - Prob. 25CYPCh. 16.6 - Prob. 21ELOCh. 16.6 - Explain the origins of autoimmunity and describe...Ch. 16.6 - Prob. 23ELOCh. 16.6 - Explain the pathologic process in autoimmunity.Ch. 16.6 - Prob. 27CYPCh. 16.6 - Describe four major types of autoimmunity,...Ch. 16.7 - Outline the categories of immunodeficiency...Ch. 16.7 - Prob. 25ELOCh. 16.7 - Relate examples of secondary immunodeficiencies.Ch. 16.7 - Prob. 29CYPCh. 16.7 - Prob. 30CYPCh. 16.7 - Prob. 31CYPCh. 16.7 - Define cancer, and differentiate between a benign...Ch. 16.7 - Describe the relationship between cancer and the...Ch. 16.8 - Describe the characteristics of cancer, and...Ch. 16.8 - Explain how immune function relates to the...Ch. 16.L1 - Prob. 1MCQCh. 16.L1 - Prob. 2MCQCh. 16.L1 - Which hypersensitivities are T-cell mediated? a....Ch. 16.L1 - The contact with allergen that results in symptoms...Ch. 16.L1 - Prob. 5MCQCh. 16.L1 - Prob. 6MCQCh. 16.L1 - Prob. 7MCQCh. 16.L1 - Prob. 8MCQCh. 16.L1 - Prob. 9MCQCh. 16.L1 - Prob. 10MCQCh. 16.L1 - Prob. 11MCQCh. 16.L1 - A positive tuberculin skin test is an example of...Ch. 16.L1 - Prob. 13MCQCh. 16.L1 - Prob. 14MCQCh. 16.L1 - Prob. 15MCQCh. 16.L1 - How is the immune system involved in development...Ch. 16.L1 - Pollen is which type of allergen? a. anti-a alone...Ch. 16.L1 - Prob. 2CSRCh. 16.L1 - Prob. 3CSRCh. 16.L1 - Compare and contrast atopic allerg and type IV...Ch. 16.L1 - Prob. 2WCCh. 16.L1 - Why is a hemolytic transfusion reaction considered...Ch. 16.L1 - Prob. 4WCCh. 16.L1 - Explain how people with autoimmunity could develop...Ch. 16.L2 - Suggest some possible physiological benefits of...Ch. 16.L2 - Prob. 2CTCh. 16.L2 - Why would a person be allergic to strawberries...Ch. 16.L2 - a. Where in the course of type I allergies do...Ch. 16.L2 - Although we call persons with type O blood...Ch. 16.L2 - Prob. 6CTCh. 16.L2 - Prob. 7CTCh. 16.L2 - How can a person prevent becoming allergic to...Ch. 16.L2 - Prob. 9CTCh. 16.L2 - a. Explain why babies with agammaglobulinemia do...Ch. 16.L2 - In what ways can cancer be both a cause and a...Ch. 16.L2 - Looking at figure 15.8, reproduced here, explain...Ch. 16.L2 - Prob. 2VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Immune System Diseases and Disorders; Author: Heather Davis;https://www.youtube.com/watch?v=3lIkxNv7MVI;License: Standard youtube license