Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 11P
Injection of double-stranded RNA can lead to gene silencing by degradation of RNA molecules complementary to either strand of the dsRNA. Could RNAi (see Sections
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Several common antibiotics affect some strains of bacteria's ability to carry out transcription and/or translation. For example:
Rifamycin inhibits prokaryotic RNA polymerase
Chloramphenicol blocks the transfer of the peptide from the P to A site.
a) For each of these drugs, identify at what point it could affect the process of DNA->RNA->protein. Be as specific as possible.
b) Why do you think these drugs kill bacteria but spare animal cells? (Hint: remember bacteria are prokaryotes)
Gene expression can be disrupted by techniques such as homologous recombination and RNA interference. What is the functional difference between these two methods in terms of the ultimate effect on gene expression? Why might homologous recombination or an alternative genome-editing method (e.g., CRISPR/Cas9) be preferred over RNA interference?
Fill in the Table
Broad Topic:
Specific Topic:
What is known:
Experimental Question:
Panel
Technique
These data show:
Figure 1
A
B
C
Chapter 15 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 15 - 15.1 What purpose do the bla and lacZ genes serve...Ch. 15 - The human genome is 3109 bp in length. How many...Ch. 15 - 15.3 Ligase catalyzes a reaction between the...Ch. 15 - You have constructed four different libraries: a...Ch. 15 - Using the genomic libraries in Problem 4, you wish...Ch. 15 - The human genome is 3109bp. You wish to design a...Ch. 15 - 15.7 Using animal models of human diseases can...Ch. 15 - 15.8 Compare methods for constructing homologous...Ch. 15 - 15.9 Chimeric genefusion products can be used for...Ch. 15 - 15.10 Why are diseases of the blood simpler...
Ch. 15 - Injection of double-stranded RNA can lead to gene...Ch. 15 - Compare and contrast methods for making transgenic...Ch. 15 - 15.13 It is often desirable to insert cDNAs into a...Ch. 15 - 15.14 A major advance in the s was the development...Ch. 15 - 15.15 The bacteriophage lambda genome can exist in...Ch. 15 - 15.16 The restriction enzymes Xho and Sal cut...Ch. 15 - 15.17 The bacteriophage has a single-stranded DNA...Ch. 15 - 15.18 To further analyze the CRABS CLAW gene (see...Ch. 15 - You have isolated a genomic clone with an EcoR I...Ch. 15 - 15.20 You have identified a cDNA clone that...Ch. 15 - 15.21 You have isolated another cDNA clone of the...Ch. 15 - 15.22 You have identified five genes in S....Ch. 15 - You have generated three transgenic lines of maize...Ch. 15 - 15.24 Bacterial Pseudomonas species often possess...Ch. 15 - 15.25 Two complaints about some transgenic plants...Ch. 15 - 15.26 In Drosophila, lossoffunction Ultrabithorax...Ch. 15 - Prob. 27PCh. 15 - The highlighted sequence shown below is the one...Ch. 15 - Vitamin E is the name for a set of chemically...Ch. 15 - The RAS gene encodes a signaling protein that...Ch. 15 - 15.31 You have cloned a gene for an enzyme that...Ch. 15 - 15.32 About of occurrences of nonautoimmune type...Ch. 15 - Describe how having the Cas 9 gene at a genomic...Ch. 15 - 15.34 Would a gene drive system spread rapidly...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present? Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ Mutant:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGC AGAGCATACTGAGGGTAGTAG-3’ Answer: Is this a transition mutation? because there is an exchange of G instead of A? It kind of confuses me a little. helparrow_forwardDescribe what would happen to the lac operon in a low-lactose environment and in a high lactose environment. a) How will each of these environments affect gene expression? b) What would happen to the repressor in each case? c) How will each of these environments affect RNA polymerase?arrow_forwardNonearrow_forward
- Prior to the publication of the article from which this assay comes from (picture), the Cas9 endonuclease was known to be involved in CRISP RNA (crRNA) maturation, but the mechanism by which Cas9 participates in targeted DNA disruption was unknown. To test whether and how Cas9 might be able to target DNA cleavage, researchers developed an in vitro assay. One of the first steps was to purify the Cas9 protein from Streptococcus pyogenes and several orthologs. The description of the figure states: SDS-PAGE analysis of purified Cas9 orthologs. Cas9 orthologs were purified as described in Supplementary Materials and Methods. 2.5 ug of each purified Cas9 were analyzed on a 4-20% gradient polyacrylamide gel and stained with SimplyBlue Safe Stain. Answer the following questions based on this information and the figure. a. Results: Explain the data in terms of observations and patterns. b. Conclusion: Describe how the data support or not support the hypothesis. c. Briefly describe a next…arrow_forwardThe ability to selectively modify the genome in the mouse has revolutionized mouse genetics. Outline the procedure for generating a knockout mouse at a specific genetic locus. How can the loxP-Cre system be used to conditionally knock out a gene? What is an important medical application of knockout mice?arrow_forwardWhat type of RNAi silencing targets DNA? What mechanism does this type of RNAi use? Group of answer choices siRNA; results in methylation of DNA miRNA; results in methylation of the DNA siRNA; results in degradation of DNA asRNA; results in degradation of the DNA asRNA; results in methylation of the DNA miRNA; results in degradation of the DNAarrow_forward
- Prior to the publication of the article from which this assay comes from (picture), the Cas9 endonuclease was known to be involved in CRISPR RNA (crRNA) maturation, but the mechanism by which Cas9 participates in targeted DNA disruption was unknown. To test whether and how Cas9 might be able to target DNA cleavage, researchers developed an in vitro assay. One of the first steps was to purify the Cas9 protein from Streptococcus pyogenes and several orthologs. The description of the figure states: SDS-PAGE analysis of purified Cas9 orthologs. Cas9 orthologs were purified as described in Supplementary Materials and Methods. 2.5 ug of each purified Cas9 were analyzed on a 4-20% gradient polyacrylamide gel and stained with SimplyBlue Safe Stain. Answer the following questions based on this information and the figure. a. What is the experimental/research question and state a hypothesis related to this question. b. What is the approach of the figure and provide a description of techniques…arrow_forwardArrange the steps that would be used in a laboratory to engineer a bacterium that could express the human gene coding for factor VIII. (Not all steps will be placed).arrow_forwardBased on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’arrow_forward
- A newly identified protein from the cells of the Panopyra plant on Pandora was shown to inhibit translation of its target genes by binding to the 5’ UTR of the mRNA and preventing ribosome binding. A possible way this inhibition may be relieved by an sRNA would be: Group of answer choices a)The sRNA acts as a silencer, suppressing the inhibitory protein and allowing translation to take place. b)The sRNA acts as a decoy, sequestering the inhibitory protein and allowing translation to take place. c)The sRNA acts as a marker, flagging the inhibitory protein for ubiquitination and allowing translation to take place.arrow_forwardTwo approaches for correcting single-gene defects are gene therapy such as is discussed in Section 3-5D and the CRISPR–Cas9 system. Explain why the CRISPR–Cas9 approach can potentially provide more complete restoration of normal tissue function than gene therapy.arrow_forwardWhat is homologous recombination and where/when does it typically take place in an organism. Homologous recombination is also used experimentally during gene targeting. If you wanted to remove the function of the mouse gene fibroblast growth factor 4 (FGF4) using gene targeting by homologous recombination, what are the different aspects of a targeting vector you would need to make?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY