Campbell Biology in Focus (2nd Edition)
2nd Edition
ISBN: 9780321962751
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14.5, Problem 3CC
WHAT IF? DRAW IT The template strand of a gene includes this sequence: 3’-TACTTGTCCGATATC-5'. It is mutated to 3’-TACTTGTCCAATATC-5’. For both versions, draw the DNA, the mRNA, and the encoded amino acid sequence. What is the effect on the amino acid sequence?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
HELP PLEASE !!
In moelcular genetics, initiation is often accomplished using proteins that prevent elongation. Name and describe 3 processes where this happens, they can be in different species. Make sure to name or describe the proteins and substrates involved and how the elongation inhibition is overcome.
Do all
Thx!
Chapter 14 Solutions
Campbell Biology in Focus (2nd Edition)
Ch. 14.1 - MAKE CONNECTIONS In a research article about...Ch. 14.1 - What polypeptide product would you expect from a...Ch. 14.1 - DRAW IT The template strand of a gene contains the...Ch. 14.2 - What is a promoter? Is it located at the upstream...Ch. 14.2 - What enables RNA polymerase to start transcribing...Ch. 14.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 14.3 - Given that there are about 20,000 human genes, how...Ch. 14.3 - How is RNA splicing similar to how you would watch...Ch. 14.3 - WHAT IF? What would be the effect of treating...Ch. 14.4 - What two processes ensure that the correct amino...
Ch. 14.4 - Discuss the ways in which rRNA structure likely...Ch. 14.4 - Describe how a polypeptide to be secreted is...Ch. 14.4 - WHAT IF? DRAW IT Draw a tRNA with the anticodon...Ch. 14.5 - What happens when one nucleotide pair is lost from...Ch. 14.5 - Prob. 2CCCh. 14.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 14 - In eukaryotic cells, transcription cannot begin...Ch. 14 - Prob. 2TYUCh. 14 - The anticodon of a particular tRNA molecule is A....Ch. 14 - Prob. 4TYUCh. 14 - Which component is not directly involved in...Ch. 14 - Prob. 6TYUCh. 14 - Prob. 7TYUCh. 14 - Prob. 8TYUCh. 14 - Fill in the following table: Type of RNA Functions...Ch. 14 - SCIENTIFIC INQUIRY Knowing that the genetic code...Ch. 14 - Prob. 11TYUCh. 14 - FOCUS ON INFORMATION Evolution accounts for the...Ch. 14 - SYNTHESIZE YOUR KNOWLEDGE Some mutations result in...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (4th Edition)
Match the people in column A to their contribution toward the advancement of microbiology, in column B. Column ...
Microbiology: An Introduction
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth
The correct term for production of offspring. Introduction: Reproduction is an important life process for most ...
Biology Illinois Edition (Glencoe Science)
What are the cervical and lumbar enlargements?
Principles of Anatomy and Physiology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Plz asaparrow_forwardconstruct! Which of the four constructs (Construct 1-4) below could you use to make your own mouse knockout? For each one you did not choose, explain why you did not choose that construct. Part of DHCR7 gene structure is shown on top row in the schematic. (Antibiotic selection and negative selection genes have been abbreviated.) Gene DHCR7 Intron 1 Exon 2 Intron 2 Exon 3 Exon1 Construct #1 Construct #2 Intron1 Negative Sel. Intron1 |Antibio. Sel. Negative Sel. Intron2 Antibio. Sel Intron 2 Construct #3 Construct #4 Introni Antibio. Sel Negative Sel. Negative Sel. Antibio. Sel. Intron2 Intron1 Intron2arrow_forwardwhich multiple choice?arrow_forward
- pls help me to do these my activity and answer properlyarrow_forward13arrow_forwardNeed help 1.The RNAs acting in RNAi are about 18 nucleotides long. To judge whether it is possible to uniquely target a particular gene with an RNA of this size, consider the following calculation: what is the expected frequency of occurrence of a specific 18 nucleotide sequence? a.The probability of finding this sequence is ___ . b.Therefore, the frequency of occurrence of this sequence is one in ___ nucleotides. c.The fruit fly genome consists of 1.2×108 base pairs.Using the logic in part a., calculate the minimum length of a unique DNA sequence expected to occur by chance just once in the fruit fly genome. Length = __ base pairsarrow_forward
- Plz asaparrow_forwardPLs help me asap !!arrow_forward5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’sarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY