Campbell Biology In Focus
2nd Edition
ISBN: 9780134203072
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 10TYU
SCIENTIFIC INQUIRY
Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (shown in Figure 14.12) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
None
Give only typing answer with explanation and conclusion
Consider the following DNA sequence, which codes for a short polypeptide:
5'-ATGGGCTTAGCGTAGGTTAGT-3'
Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark.
How many amino acids will make up this polypeptide?
Determine the first four anticodons that will be used in order to translate this sequence.
Chapter 14 Solutions
Campbell Biology In Focus
Ch. 14.1 - MAKE CONNECTIONS In a research article about...Ch. 14.1 - What polypeptide product would you expect from a...Ch. 14.1 - DRAW IT The template strand of a gene contains the...Ch. 14.2 - What is a promoter? Is it located at the upstream...Ch. 14.2 - What enables RNA polymerase to start transcribing...Ch. 14.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 14.3 - Given that there are about 20,000 human genes, how...Ch. 14.3 - How is RNA splicing similar to how you would watch...Ch. 14.3 - WHAT IF? What would be the effect of treating...Ch. 14.4 - What two processes ensure that the correct amino...
Ch. 14.4 - Discuss the ways in which rRNA structure likely...Ch. 14.4 - Describe how a polypeptide to be secreted is...Ch. 14.4 - WHAT IF? DRAW IT Draw a tRNA with the anticodon...Ch. 14.5 - What happens when one nucleotide pair is lost from...Ch. 14.5 - Prob. 2CCCh. 14.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 14 - In eukaryotic cells, transcription cannot begin...Ch. 14 - Prob. 2TYUCh. 14 - The anticodon of a particular tRNA molecule is A....Ch. 14 - Prob. 4TYUCh. 14 - Which component is not directly involved in...Ch. 14 - Prob. 6TYUCh. 14 - Prob. 7TYUCh. 14 - Prob. 8TYUCh. 14 - Fill in the following table: Type of RNA Functions...Ch. 14 - SCIENTIFIC INQUIRY Knowing that the genetic code...Ch. 14 - Prob. 11TYUCh. 14 - FOCUS ON INFORMATION Evolution accounts for the...Ch. 14 - SYNTHESIZE YOUR KNOWLEDGE Some mutations result in...
Additional Science Textbook Solutions
Find more solutions based on key concepts
An obese 55-year-old woman consults her physician about minor chest pains during exercise. Explain the physicia...
Biology: Life on Earth with Physiology (11th Edition)
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (7th Edition)
To test your knowledge, discuss the following topics with a study partner or in writing ideally from memory. Th...
HUMAN ANATOMY
Whether two metal foil leaves an electroscope get opposite charge when the electroscope is charged.
Physics of Everyday Phenomena
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Hi, Can someone solve this question, what are the steps of translation in order based on when they occur? It would be nice if some solved itarrow_forward. The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution muta- tions (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons. (a) How many total mutations are possible? (b) How many of these mutations are "silent," in the sense that the mutant codon is changed to another Arg codon? (c) How many of these mutations are conservative, in the sense that an Arg codon is changed to a functionally similar Lys codon?arrow_forwardGive typing answer with explanation and conclusionarrow_forward
- 10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence anarrow_forwardMatch each of the following examples with the hypothesis it argues against. Example The gene coding for keratin A gene coding for a tRNA Three genes, each coding for one of the G protein subunits (a, ß and y) A gene that undergoes alternative splicing Hypothesis One gene → one polypeptide One gene→→ one enzyme One gene → one protein One gene → one proteinarrow_forwardExplain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'arrow_forward
- Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.arrow_forwardIn regard to the wobble hypothesis and the fact that cells do not need a full complement of tRNAs for codons. What would the consequences be if a cell lost the tRNA gene with the following anticodon sequences Please explain in depth A. 3'-ACA-5' B. 3'-CUG-5'arrow_forwardGive a clear explanation answer..no need handwrittenarrow_forward
- A group of researchers isolate 'Protein X' from the wall of a human stomach with the intent of learning how to synthesize stomach tissue in the lab. Subsequently, they determine the exact sequence of amino acids of the protein in its unfolded state, and create a functional mRNA template to translate Protein X in vitro. They manage to translate an exact copy of the polypeptide chain in the lab, but then realize that it takes several days for the protein to fold into its final tertiary structure. In vivo, they observe that several thousand copies of Protein X are folded from polypeptide chains every minute. What is NOT a plausible explanation for this difference in folding times? The in vitro study lacks a key enzyme The temperature in vitro is too low The in vitro study lacks a key tRNA molecule The pH in vitro is too higharrow_forwardOxytocin is a small peptide hormone. It contains a nine amino acid sequence shown below: CYIQNCPLG 33 How many nucleotides would be found in the mRNA for this protein? Suggest an mRNA sequence for the peptide. Write in as 5' XXX 3' (no spaces between nucleotides). Keep in mind, for a protein to be synthesized it needs to include a start codon and a stop codon. Suggest a complementary template DNA sequence based on the MRNA sequences suggested above. Write in as 3' XXX 5' (no spaces between nucleotides).arrow_forwardThe figure below shows the stage in translation when an incoming aminoacyl-tRNA has bound to the A site on the ribosome. Using the components shown in A as a guide, show on B and C what happens in the next two stages to complete the addition of the new amino acid to the growing polypeptide chain.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology - Intro to Cell Structure - Quick Review!; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=vwAJ8ByQH2U;License: Standard youtube license