Prescott's Microbiology
10th Edition
ISBN: 9781259281594
Author: Joanne Willey, Linda Sherwood Adjunt Professor Lecturer, Christopher J. Woolverton Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 13.6, Problem 1MI
Summary Introduction
In translation, the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as
well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 867
nucleotides in length, and the other is 685 nucleotides in length. Name the process responsible for producing
this variation. Also explain how these 867 and 685 nucleotide fragments were produced by referring to the
information provided.
Hint: This organism produces a poly-A tail of 150 nucleotides.
The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this
organism found that two mature MRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439
nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide
fragments were produced by referring to the information provided.
Hint: This organism produces a poly-A tail of 120 nucleotides.
99
62
120
84
102 27
117
Gene X
E1
в в
11
E2
12
E4
Exon (E)
Intron (1)
The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides.
Chapter 13 Solutions
Prescott's Microbiology
Ch. 13.1 - MICRO INQUIRY Based on what we now know about...Ch. 13.1 - Retrieve, Infer, Apply 1. Briefly summarize the...Ch. 13.1 - Retrieve, Infer, Apply 2. Explain how protein was...Ch. 13.2 - MICRO INQUIRY To which carbon of ribose...Ch. 13.2 - MICRO INQUIRY How many H bonds are there between...Ch. 13.2 - Prob. 3MICh. 13.2 - Prob. 1RIACh. 13.2 - Retrieve, Infer, Apply What does it mean to say...Ch. 13.2 - Retrieve, Infer, Apply Amino acids are described...Ch. 13.3 - MICRO INQUIRY What provides the energy to fuel...
Ch. 13.3 - MICRO INQUIRY What is the difference between...Ch. 13.3 - MICRO INQUIRY Why cant DNA polymerase I perform...Ch. 13.3 - Retrieve, Infer, Apply How many replicons do...Ch. 13.3 - Retrieve, Infer, Apply Describe the nature and...Ch. 13.3 - Retrieve, Infer, Apply Outline the steps Involved...Ch. 13.3 - Retrieve, Infer, Apply What is the end replication...Ch. 13.4 - Why is the nontemplate strand called the sense...Ch. 13.4 - Retrieve, Infer, Apply The coding region of a gene...Ch. 13.4 - Which strand of a gene has sequences that...Ch. 13.4 - Briefly discuss the general organization of tRNA...Ch. 13.5 - MICRO INQUIRY Are the -35 and -10 regions...Ch. 13.5 - Retrieve, Infer, Apply Outline the transcription...Ch. 13.5 - Retrieve, Infer, Apply What is a polycistronic...Ch. 13.5 - Retrieve, Infer, Apply What is a consensus...Ch. 13.5 - Tabulate the similarities and differences between...Ch. 13.6 - Prob. 1MICh. 13.6 - Retrieve, Infer, Apply List the punctuation codons...Ch. 13.6 - What is the difference between a codon and an...Ch. 13.6 - Retrieve, Infer, Apply What is meant by code...Ch. 13.6 - Retrieve, Infer, Apply Is the genetic code truly...Ch. 13.7 - MICRO INQUIRY Why is simultaneous transcription...Ch. 13.7 - MICRO INQUIRY What would be the outcome if an...Ch. 13.7 - MICRO INQUIRY Why would it be impossible for...Ch. 13.7 - MICRO INQUIRY What provides the energy to fuel...Ch. 13.7 - Retrieve, Infer, Apply In which direction are...Ch. 13.7 - Retrieve, Infer, Apply Briefly describe the...Ch. 13.7 - Retrieve, Infer, Apply What are the translational...Ch. 13.7 - Retrieve, Infer, Apply Tabulate the nature and...Ch. 13.7 - Retrieve, Infer, Apply How many ATP and GTP...Ch. 13.8 - MICRO INQUIRY What are two distinguishing features...Ch. 13.8 - Retrieve, Infer, Apply What are molecular...Ch. 13.8 - Retrieve, Infer, Apply Would an intein-containing...Ch. 13.8 - Retrieve, Infer, Apply Give the major...Ch. 13.8 - Retrieve, Infer, Apply Which translocation or...Ch. 13.8 - Prob. 5RIACh. 13 - Streptomyces coelicolor has a linear chromosome....Ch. 13 - You have isolated several E. coli mutants: Mutant...Ch. 13 - DNA polymerase I (Pol I) of E. coli consists of...Ch. 13 - Prob. 4CHI
Knowledge Booster
Similar questions
- The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides. 99 62 120 84 102 27 117 Gene X E1 11 E2 12 ЕЗ 13 E4 Exon (E) Intron (I)arrow_forwardConsider a single base insertion mutation between the 3rd and 4th codons in a natural gene that encodes a protein 100 amino acids long. Is it more likely that the protein produced by this mutant allele will be shorter or longer than 100 amino acids long?arrow_forwardConsider the tryptophan codon 5′ - UGG - 3′ in the standard genetic code . Can a single base change in this codon create a synonymous mutation? Can a single base change in this codon create a nonsense codon?arrow_forward
- Below is an MRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz are numbered as shown. Answer questions 1-4 for the mRNA of Lstqz. A codon table with amino acids shown in single-letter code has been provided at this link. 1 5 10 15 20 25 30 35 40 5' AGAGAUGGCUCCUUCACGCUUUACCUACUGAGUAGGGCUAAG 3’ Which nucleotide number corresponds to the first nucleotide of the stop codon? (Please answer as a numeric value) 30 Write down the first five amino acids generated from this mRNA in single-letter designation with no spaces. Example: if the answer is (from N to C terminus) Histidine-Threonine-Glutamate, you would put in HTE (uppercase) as the answer.arrow_forwardFor each codon, provide the anticodon and the three-letter abbreviation of the amino acid for which it codes. Consult the codon table as needed. 5'-AUU-3' anticodon: 3'- -5' amino acid: 5' -UCU-3' anticodon: 3'- -5' amino acid: 5' -CAG-3' anticodon: 3'- -5' amino acid:arrow_forwardA mutation that changes a C to a T causes a type of Ehlers-Danlos syndrome, forming a “stop” codon and resulting in shortened procollagen. Consult the genetic code and suggest one way that this can happen.arrow_forward
- Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-GCAAGUCUUAAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn 2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.arrow_forwardDNA mutations can affect the reading frame for the genetic code. What is a human condition caused by these mutations? Identify how the reading frame is affected.arrow_forwardWhat percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?arrow_forward
- The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?arrow_forwardYou take DNA samples from a family with a history of the genetic disease spinal muscular atrophy, which results from many different mutations in the SMA gene. One mutation in the SMA gene is a 240-bp in-frame deletion mutation in the middle of an exon. Data from this family shows you that several individuals from the family have this mutation. What do you predict that you would find when comparing the mRNA and protein products of the mutated and unmutated SMA gene? Select all that apply. 1. The mRNA from the SMA is more stable than unmutated SMA mRNA. 2. The pre-mRNA from the SMA mutant is shorter than the unmutated SMA pre-mRNA. 3. The mature mRNA from the SMA mutant is longer than the unmutated SMA mRNA. 4. The protein from the mutated SMA is shorter than the unmutated SMA protein.arrow_forwardA molecular geneticist hopes to find a gene gene in human liver cells that codes for an important blood clotting protein. He knows that the nucleotides sequence of a small part of the gene is GTGGACTGACA. briefly explain how to obtain the desired genearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning