Prescott's Microbiology
10th Edition
ISBN: 9781259281594
Author: Joanne Willey, Linda Sherwood Adjunt Professor Lecturer, Christopher J. Woolverton Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13.7, Problem 3MI
MICRO INQUIRY
Why would it be impossible for fMet-tRNA to initiate peptide bond formation with another amino acid? (Hint: Examine figure 13.40 closely.)
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
BIOLOGY ACTIVITY -Gene Mutations and Proteins
Objective: To demonstrate how gene mutations affect the production of proteins?
Procedure:
1. Use the following base sequence of one strand of an
AATTGAACACATGCGCCC.
imaginary DNA molecule:
2 Write the base sequence for an mRNA strand that would be transcribed from the given
DNA sequence. Place your results in the table below.
3. Use your codon table provided below to determine the sequence of amino acids in the
resulting protein fragment. Place your results in the table below.
4. If the fifth base in the original DNA strand were changed from G to C, how would this
affect the resulting protein fragment? Write the new protein fragment in the table
below.
5. If G were added to the original DNA strand after the third base, what would the
resulting mRNA look like? How would this addition affect the protein? Show your
results in the table below.
Data:
mRNA from
Step 2
Protein Sequence
from Step 3
Protein Sequence
from Step 4
mRNA from Step 5…
Pls Provide what is being asked in the picture given
Give Detailed Solution (no need Handwritten)
Chapter 13 Solutions
Prescott's Microbiology
Ch. 13.1 - MICRO INQUIRY Based on what we now know about...Ch. 13.1 - Retrieve, Infer, Apply 1. Briefly summarize the...Ch. 13.1 - Retrieve, Infer, Apply 2. Explain how protein was...Ch. 13.2 - MICRO INQUIRY To which carbon of ribose...Ch. 13.2 - MICRO INQUIRY How many H bonds are there between...Ch. 13.2 - Prob. 3MICh. 13.2 - Prob. 1RIACh. 13.2 - Retrieve, Infer, Apply What does it mean to say...Ch. 13.2 - Retrieve, Infer, Apply Amino acids are described...Ch. 13.3 - MICRO INQUIRY What provides the energy to fuel...
Ch. 13.3 - MICRO INQUIRY What is the difference between...Ch. 13.3 - MICRO INQUIRY Why cant DNA polymerase I perform...Ch. 13.3 - Retrieve, Infer, Apply How many replicons do...Ch. 13.3 - Retrieve, Infer, Apply Describe the nature and...Ch. 13.3 - Retrieve, Infer, Apply Outline the steps Involved...Ch. 13.3 - Retrieve, Infer, Apply What is the end replication...Ch. 13.4 - Why is the nontemplate strand called the sense...Ch. 13.4 - Retrieve, Infer, Apply The coding region of a gene...Ch. 13.4 - Which strand of a gene has sequences that...Ch. 13.4 - Briefly discuss the general organization of tRNA...Ch. 13.5 - MICRO INQUIRY Are the -35 and -10 regions...Ch. 13.5 - Retrieve, Infer, Apply Outline the transcription...Ch. 13.5 - Retrieve, Infer, Apply What is a polycistronic...Ch. 13.5 - Retrieve, Infer, Apply What is a consensus...Ch. 13.5 - Tabulate the similarities and differences between...Ch. 13.6 - Prob. 1MICh. 13.6 - Retrieve, Infer, Apply List the punctuation codons...Ch. 13.6 - What is the difference between a codon and an...Ch. 13.6 - Retrieve, Infer, Apply What is meant by code...Ch. 13.6 - Retrieve, Infer, Apply Is the genetic code truly...Ch. 13.7 - MICRO INQUIRY Why is simultaneous transcription...Ch. 13.7 - MICRO INQUIRY What would be the outcome if an...Ch. 13.7 - MICRO INQUIRY Why would it be impossible for...Ch. 13.7 - MICRO INQUIRY What provides the energy to fuel...Ch. 13.7 - Retrieve, Infer, Apply In which direction are...Ch. 13.7 - Retrieve, Infer, Apply Briefly describe the...Ch. 13.7 - Retrieve, Infer, Apply What are the translational...Ch. 13.7 - Retrieve, Infer, Apply Tabulate the nature and...Ch. 13.7 - Retrieve, Infer, Apply How many ATP and GTP...Ch. 13.8 - MICRO INQUIRY What are two distinguishing features...Ch. 13.8 - Retrieve, Infer, Apply What are molecular...Ch. 13.8 - Retrieve, Infer, Apply Would an intein-containing...Ch. 13.8 - Retrieve, Infer, Apply Give the major...Ch. 13.8 - Retrieve, Infer, Apply Which translocation or...Ch. 13.8 - Prob. 5RIACh. 13 - Streptomyces coelicolor has a linear chromosome....Ch. 13 - You have isolated several E. coli mutants: Mutant...Ch. 13 - DNA polymerase I (Pol I) of E. coli consists of...Ch. 13 - Prob. 4CHI
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Pls help ASAP.arrow_forwardSDS-PAGE with and without DDT suggests that a protein contains two peptides linked by a disulfide bond. How would you process the protein so that it can be sequenced by the Edman degradation method?arrow_forwardm-RNA analysis How How to protect the messenger RNA from lysis by proteases?arrow_forward
- BIOLOGY ACTIVITY -Gene Mutations and Proteins Objective: To demonstrate how gene mutations affect the production of proteins? Procedure: Use the following base sequence of one strand of an imaginary DNA molecule: AATTGAACACATGCGCCC. 2. Write the base sequence for an mRNA strand that would be transcribed from the given DNA sequence. Place your results in the table below. Use your codon table provided below to determine the sequence of amino acids in the resulting protein fragment. Place your results in the table below. If the fifth base in the original DNA strand were changed from G to C, how would this affect the resulting protein fragment? Write the new protein fragment in the table below. If G were added to the original DNA strand after the third base, what would the resulting mRNA look like? How would this addition affect the protein? Show your results in the table below. Data: mRNA from Step 2 Protein Sequence from Step 3 Protein Sequence from Step…arrow_forwardPlz asaparrow_forwardQuestion Describe how you could use CRISPR-Cas9 gene editing to alter a specific genomic DNA sequence in a eukaryotic organism in order to: A) knock out the gene, and B) change a single codon of the gene?arrow_forward
- asap please A partially filled diagram of eukaryotic gene structure is shown below. Label the following additional elements in the empty boxes. One label must be used twice: a) 3'UTR, b) 5'UTR, c) exon, d) intron, e) promoterarrow_forwardGive typed full explanation Given the following sequence of RNA, propose the potential hairpin structure for this RNA. Indicate base pairing with a dotted line. 5’ -AGGACCCUUCGGGGUUCU-3’arrow_forwardmicrobilogy question, what is the purpose of RNA processing in eukaryotes? why dont prokaryotes require similar processing?arrow_forward
- Practice testarrow_forwardYes or no? Is sequence of riboprobe identical to the mrna produced by gene in situ hybridization? does column of purification in DNA allow it to flow while other molecules are trapped ?arrow_forwardCentral Dogma Application: Using the basic concept of Process of central dogma provide the following answer in the given DNA sequence on how genetic information flow. IV. Given DNA Sequence: ATCGATCGCGATCGATTACATATGCGCCCCTTTTTCCCGGGAATAATGCTAGCTAGCATGCATCAG Product of Replication: ( Product of Transcription: Product of Translation: {.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY