Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12.4, Problem 1MQ
- How can site-directed mutagenesis be useful to enzymologists?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 12 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 12.1 - Why is a primer needed at each end of the DNA...Ch. 12.1 - How does RT-PCR differ from traditional PCR?Ch. 12.1 - Prob. 3MQCh. 12.1 - Describe the basic principles of gene...Ch. 12.2 - What is the purpose of molecular cloning?Ch. 12.2 - Prob. 2MQCh. 12.2 - Prob. 3MQCh. 12.2 - Prob. 1CRCh. 12.3 - How can the bacteriophage T7 promoter be used to...Ch. 12.3 - What major advantage does cloning mammalian genes...
Ch. 12.3 - Prob. 3MQCh. 12.3 - Prob. 1CRCh. 12.4 - How can site-directed mutagenesis be useful to...Ch. 12.4 - What is used to alter more than a few base pairs...Ch. 12.4 - What are knockout mutations?Ch. 12.4 - What does site-directed mutagenesis allow you to...Ch. 12.5 - What is a reporter gene? The product of which...Ch. 12.5 - Prob. 2MQCh. 12.5 - Describe two widely used reporter genes.Ch. 12.6 - Prob. 1MQCh. 12.6 - Prob. 2MQCh. 12.6 - Prob. 3MQCh. 12.6 - Prob. 1CRCh. 12.7 - Prob. 1MQCh. 12.7 - Give an example of a genetically modified plant...Ch. 12.7 - How have transgenic salmon been engineered to...Ch. 12.7 - What is the Ti plasmid and how has it been of use...Ch. 12.8 - Explain why recombinant vaccines might be safer...Ch. 12.8 - Prob. 2MQCh. 12.8 - Prob. 3MQCh. 12.8 - What is a subunit vaccine and why are subunit...Ch. 12.9 - Explain why metagenomic cloning gives large...Ch. 12.9 - What types of environments are often sampled to...Ch. 12.9 - Prob. 3MQCh. 12.9 - How has metagenomics been used to find novel...Ch. 12.10 - How has Caldicellulosiruptor been modified to...Ch. 12.10 - Prob. 2MQCh. 12.10 - What has been the limiting factor in engineering...Ch. 12.10 - Prob. 1CRCh. 12.11 - What are biobricks?Ch. 12.11 - Prob. 2MQCh. 12.11 - How was Escherichia coli modified to produce a...Ch. 12.11 - Prob. 1CRCh. 12.12 - Prob. 1MQCh. 12.12 - Prob. 2MQCh. 12.12 - How is recombinant DNA inserted into a genome...Ch. 12.12 - How has the CRISPR editing technology been applied...Ch. 12.13 - Prob. 1MQCh. 12.13 - How can a tRNA be engineered to encode for a...Ch. 12.13 - Prob. 3MQCh. 12.13 - What are some mechanisms for controlling a...Ch. 12 - Suppose you have just determined the DNA base...Ch. 12 - Prob. 2AQCh. 12 - Prob. 3AQCh. 12 - Describe how you could recode Escherichia coli to...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Case Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
What is cancer? What causes cancer and how is it treated? *UPDATE*; Author: Cancer Treatment Centers of America - CTCA;https://www.youtube.com/watch?v=_N1Sk3aiSCE;License: Standard Youtube License