
Anatomy & Physiology (6th Edition)
6th Edition
ISBN: 9780134156415
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12.1, Problem 2CYU
Summary Introduction
To review:
The two areas of the adult brain that have an outside layer of gray matter along with the central gray matter and surrounding white matter.
Introduction:
The brain is filled with neurons. The outer layer of the brain has the cell bodies of the neurons and is known as gray matter. On the other hand, the inner layer is filled with axons of the neurons and is known as white matter. Gray matter and white matter arepresent in every part of the brain, except in the brain stem and spinal cord. In these regions, white matter is present as an outer layer and gray matter as an inner layer.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 12 Solutions
Anatomy & Physiology (6th Edition)
Ch. 12.1 - Which ventricle is surrounded by the diencephalon?Ch. 12.1 - Prob. 2CYUCh. 12.1 - Prob. 3CYUCh. 12.2 - What anatomical landmark of the cerebral cortex...Ch. 12.2 - Mike, who is left-handed, decided to wear his...Ch. 12.2 - Prob. 6CYUCh. 12.2 - Name the components of the basal nuclei.Ch. 12.3 - Prob. 8CYUCh. 12.3 - The hypothalamus oversees a branch of the...Ch. 12.4 - Prob. 10CYU
Ch. 12.4 - Prob. 11CYUCh. 12.5 - Prob. 12CYUCh. 12.6 - The limbic system is sometimes called the...Ch. 12.6 - When Taylor begins to feel drowsy while driving,...Ch. 12.7 - Name three factors that can enhance transfer of...Ch. 12.7 - Prob. 16CYUCh. 12.7 - Which two states of consciousness are between...Ch. 12.7 - During which sleep stage are most skeletal muscles...Ch. 12.8 - Prob. 19CYUCh. 12.8 - A brain surgeon is about to make an incision. Name...Ch. 12.9 - Prob. 21CYUCh. 12.9 - Prob. 22CYUCh. 12.10 - Prob. 23CYUCh. 12.10 - Trevor was tackled while playing football. After...Ch. 12.11 - Where are the cell bodies of the first-, second-,...Ch. 12.11 - Prob. 26CYUCh. 12.11 - Figure 12.32 shows both tracts and nerves, as well...Ch. 12 - Prob. 1MCCh. 12 - A patient has suffered a cerebral hemorrhage that...Ch. 12 - Choose the correct term from the key to respond to...Ch. 12 - The innermost layer of the meninges, delicate and...Ch. 12 - Prob. 3MCCh. 12 - Which of the following tracts convey vibration and...Ch. 12 - Destruction of the ventral horn cells of the...Ch. 12 - Prob. 8MCCh. 12 - Prob. 9MCCh. 12 - A professor unexpectedly blew a loud horn in his...Ch. 12 - Identify the stage of sleep described by using...Ch. 12 - All of the following descriptions refer to dorsal...Ch. 12 - Prob. 13SAQCh. 12 - (a) What is the advantage of having a cerebrum...Ch. 12 - (a) Make a rough drawing of the lateral aspect of...Ch. 12 - Prob. 16SAQCh. 12 - (a) What is the function of the basal nuclei? (b)...Ch. 12 - Explain how the cerebellum is physically connected...Ch. 12 - Describe the role of the cerebellum in maintaining...Ch. 12 - Prob. 20SAQCh. 12 - (a) Localize the reticular formation in the brain....Ch. 12 - Prob. 22SAQCh. 12 - Prob. 23SAQCh. 12 - Compare and contrast short-term memory (STM) and...Ch. 12 - Define memory consolidation.Ch. 12 - List four ways in which the CNS is protected.Ch. 12 - Prob. 27SAQCh. 12 - Prob. 28SAQCh. 12 - (a) Define concussion and contusion. (b) Why does...Ch. 12 - Describe the spinal cord, depicting its extent,...Ch. 12 - How do the types of motor activity controlled by...Ch. 12 - Describe the functional problems that would be...Ch. 12 - Prob. 33SAQCh. 12 - How do the conditions paraplegia, hemiplegia, and...Ch. 12 - Prob. 35SAQCh. 12 - 39-Year-Old Female with Traumatic Brain Injury...Ch. 12 - 39-Year-Old Female with Traumatic Brain Injury...Ch. 12 - 39-Year-Old Female with Traumatic Brain Injury...Ch. 12 - 39-Year-Old Female with Traumatic Brain Injury...Ch. 12 - 39-Year-Old Female with Traumatic Brain Injury...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengagePrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning