
Concept explainers
To determine:
The lobe in which primary motor cortex, Broca’s area, and premotor cortex are located:
frontal
parietal
temporal
occipital

Answer to Problem 1MC
Correct answer:
(a) Frontal: Broca’s area, the primary motor cortex, and the premotor cortex are found in the frontal lobe of the brain.
Explanation for the correct answer:
The brain of an individual consists of four different lobes. The frontal lobe is one among the four lobes and is the largest of all. It is located in the front portion of the brain. The primary motor cortex is responsible for controlling the motor functions and voluntary movements of the body and broca’s area is involved in the production of speech. So option (a) is considered as a correct answer.
Explanation of Solution
Explanation for the incorrect answers:
Option (b) is given as parietal lobe. Whereas primary motor cortex, Broca’s area, and premotor cortex are located in the frontal lobe of the brain. Parietal lobe is characterized by the presence of brodmann area 3, the primary somatosensory cortical area. Thus this option is considered as an incorrect answer.
Option (c) is given as temporal lobe. Whereas primary motor cortex, Broca’s area, and premotor cortex are located in the frontal lobe of the brain. Temporal lobe consists the hippocampus that is critical for long term memory. Thus this option is considered as an incorrect answer.
Option (d) is given as occipital lobe. Whereas primary motor cortex, Broca’s area, and premotor cortex are located in the frontal lobe of the brain. Occipital lobe acts as visual processing center of the brain and consist most of the anatomical region of visual cortex. Thus this option is considered as an incorrect answer.
Hence, option (b), (c) and (d) are considered as incorrect options.
Thus it is concluded that frontal lobe is one among the four lobes of the brain and consists primary motor cortex, Broca’s area, and premotor cortex. The primary motor cortex is responsible for controlling the motor functions and voluntary movements of the body and broca’s area is involved in the production of speech.
Want to see more full solutions like this?
Chapter 12 Solutions
Anatomy & Physiology (6th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning

