![Campbell Biology: Concepts & Connections (8th Edition)](https://www.bartleby.com/isbn_cover_images/9780321885326/9780321885326_largeCoverImage.gif)
Campbell Biology: Concepts & Connections (8th Edition)
8th Edition
ISBN: 9780321885326
Author: Jane B. Reece, Martha R. Taylor, Eric J. Simon, Jean L. Dickey, Kelly A. Hogan
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 12, Problem 9TYK
A biochemist hopes to find a gene in human cells that codes for an important blood-clotting protein. She knows that the
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain gene
A molecular geneticist hopes to find a gene gene in human liver cells that codes for an important blood clotting protein. He knows that the nucleotides sequence of a small part of the gene is GTGGACTGACA. briefly explain how to obtain the desired gene
Describe the outcome of a chain-terminator sequencing procedure in which (a) too few primers are present or (b) an excess of primers is present.
Chapter 12 Solutions
Campbell Biology: Concepts & Connections (8th Edition)
Ch. 12 - Imagine you have found a small quantity of DNA....Ch. 12 - Which of the following would be considered a...Ch. 12 - The DNA profiles used as evidence in a murder...Ch. 12 - A paleontologist has recovered a tiny bit of...Ch. 12 - How many genes are there in a human sperm cell? a....Ch. 12 - When a typical restriction enzyme cuts a DNA...Ch. 12 - Why does DNA profiling rely on comparing specific...Ch. 12 - Recombinant DNA techniques are used to...Ch. 12 - A biochemist hopes to find a gene in human cells...Ch. 12 - Prob. 10TYK
Ch. 12 - Explain how you might engineer E. coli to produce...Ch. 12 - What is left for genetic researchers to do now...Ch. 12 - Today, it is fairly easy to make transgenic plants...Ch. 12 - In the not-too-distant future, gene therapy may be...Ch. 12 - The possibility of extensive genetic testing...Ch. 12 - SCIENTIFIC THINKING Scientists investigate...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- a)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x 10-14g of a 10 kb template in a 100 µl reaction. Assuming that the molecular weight of the average base pair is 660 Daltons calculate the number of molecules of the template. b)Given that the concentration of each primer (20 base pairs each) is 0.1µM in this same reaction volume (100 µl) calculate the number of molecules of the primer presentarrow_forwardThe optimal design of primers is critical to the effective amplification of DNA sequences. i) Outline the criteria for optimal primer design. i) Illustrate forward and reverse primer sequences using an example of a hypothetical DNA fragment. Give a brief overview of an online primer design software program.arrow_forwardAilee is interested to determine the nucleotide sequence of her bacterial heat shock gene. Hence, DNA sequencing needs to be performed for this analysis. One of the earliest methods invented is known as Sanger sequencing. Explain in detail the mechanism of this sequencing technique with the aid of a simple diagram.arrow_forward
- As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explainarrow_forwardAs part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explainarrow_forwardSouthern blotting is a method used in molecular biology for detection of a specific DNA sequence in DNA samples while northern blotting is used for the detection of RNA in a sample. Write down the similarities and differences between both methods.arrow_forward
- A purified recombinant protein is analyzed for molecular weight by SDS-PAGE at pH 8.5. From the protein sequence deduced from the gene that was expressed in bacteria, the protein is expected to have a molecular weight of 44,000. However, the molecular weight of the protein is found by SDS-PAGE to be 52,000. Explain the reason or reasons for this difference in molecular weight. What calculation could you make to help explain this discrepancy?arrow_forwardPropose a method for isolating a DNA fragment that is adjacent in the genome to a previously isolated DNA fragment. Assume that you have access to a complete library of DNA fragments in a BAC vector but that the sequence of the genome under study has not yet been determined.arrow_forwardGiven below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’arrow_forward
- Damien and Jessica are friends that are interested in proteomics. One day Damien and Jessica go to a proteomics lab to have their proteome (all proteins in body) analyzed. The analysis shows that there is a difference in one amino acid within each of their hemoglobin proteins. However, both of their hemoglobin proteins appear to be functioning properly. They both come to you and ask you the significance of this finding, what do you tell them? Should they be worried? Provide a detailed rationale. .arrow_forwardIf you have access to the necessary computer software, make asequence file and analyze it in the following ways: What is thetranslated sequence in all three reading frames? What is the longest open reading frame? Is the sequence homologous to any known sequences? If so, does this provide any clues about the function of the sequence?arrow_forwardWhen the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were obtained: Tetranucleotide Hexanucleotide Nonanucleotide Decanucleotide Dodenucleotide Octadecanucleotide Nonadecanucleotide 21-nucleotide 6c. What is the sequence of the bases in the mRNA coding for the peptide above? Thearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
An Introduction to the Human Genome | HMX Genetics; Author: Harvard University;https://www.youtube.com/watch?v=jEJp7B6u_dY;License: Standard Youtube License