Computer Science: An Overview (12th Edition)
12th Edition
ISBN: 9780133760064
Author: Glenn Brookshear, Dennis Brylow
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12, Problem 11CRP
Program Plan Intro
Bare Bones:
The object of Bare Bone is to develop the simplest language possible. The presentation of Bare Boner is done by considering the variables which have been found in
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Correct and detailed answer will be Upvoted else downvoted. Thank you!
Fill out the table for executing the polynomial-time dynamic programming algo-
rithm for deciding whether the string 1001 is in the context-free language generated by the
following CFG. Fill the table completely-do not stop the algorithm early. (Note: This CFG
is not quite in Chomsky Normal Form since A appears on the right-hand side of a rule, but
|the same algorithm still works.)
A + BC | CC
B + BA | 0
с + АВ | Вв | 1
PLease answer both question with clear explanastion. Thanks in advance
1. What is the regular expression for the language, over alphabet {a, b}, of strings that start and end with the substring ab and contain one or more repetition of the substring bab.2. Describe in English the language associated with the following regular expression: (a+b)*a(a+b)*a*(a+b)*a(a+b)*
Chapter 12 Solutions
Computer Science: An Overview (12th Edition)
Ch. 12.1 - Prob. 1QECh. 12.1 - Prob. 2QECh. 12.1 - Prob. 3QECh. 12.1 - Prob. 4QECh. 12.2 - Prob. 1QECh. 12.2 - Prob. 2QECh. 12.2 - Prob. 3QECh. 12.2 - Prob. 4QECh. 12.2 - Prob. 5QECh. 12.3 - Prob. 1QE
Ch. 12.3 - Prob. 3QECh. 12.3 - Prob. 5QECh. 12.3 - Prob. 6QECh. 12.4 - Prob. 1QECh. 12.4 - Prob. 2QECh. 12.4 - Prob. 3QECh. 12.5 - Prob. 1QECh. 12.5 - Prob. 2QECh. 12.5 - Prob. 4QECh. 12.5 - Prob. 5QECh. 12.6 - Prob. 1QECh. 12.6 - Prob. 2QECh. 12.6 - Prob. 3QECh. 12.6 - Prob. 4QECh. 12 - Prob. 1CRPCh. 12 - Prob. 2CRPCh. 12 - Prob. 3CRPCh. 12 - In each of the following cases, write a program...Ch. 12 - Prob. 5CRPCh. 12 - Describe the function computed by the following...Ch. 12 - Describe the function computed by the following...Ch. 12 - Write a Bare Bones program that computes the...Ch. 12 - Prob. 9CRPCh. 12 - In this chapter we saw how the statement copy...Ch. 12 - Prob. 11CRPCh. 12 - Prob. 12CRPCh. 12 - Prob. 13CRPCh. 12 - Prob. 14CRPCh. 12 - Prob. 15CRPCh. 12 - Prob. 16CRPCh. 12 - Prob. 17CRPCh. 12 - Prob. 18CRPCh. 12 - Prob. 19CRPCh. 12 - Analyze the validity of the following pair of...Ch. 12 - Analyze the validity of the statement The cook on...Ch. 12 - Suppose you were in a country where each person...Ch. 12 - Prob. 23CRPCh. 12 - Prob. 24CRPCh. 12 - Suppose you needed to find out if anyone in a...Ch. 12 - Prob. 26CRPCh. 12 - Prob. 27CRPCh. 12 - Prob. 28CRPCh. 12 - Prob. 29CRPCh. 12 - Prob. 30CRPCh. 12 - Prob. 31CRPCh. 12 - Suppose a lottery is based on correctly picking...Ch. 12 - Is the following algorithm deterministic? Explain...Ch. 12 - Prob. 34CRPCh. 12 - Prob. 35CRPCh. 12 - Does the following algorithm have a polynomial or...Ch. 12 - Prob. 37CRPCh. 12 - Summarize the distinction between stating that a...Ch. 12 - Prob. 39CRPCh. 12 - Prob. 40CRPCh. 12 - Prob. 41CRPCh. 12 - Prob. 42CRPCh. 12 - Prob. 43CRPCh. 12 - Prob. 44CRPCh. 12 - Prob. 46CRPCh. 12 - Prob. 48CRPCh. 12 - Prob. 49CRPCh. 12 - Prob. 50CRPCh. 12 - Prob. 51CRPCh. 12 - Prob. 52CRPCh. 12 - Prob. 1SICh. 12 - Prob. 2SICh. 12 - Prob. 3SICh. 12 - Prob. 4SICh. 12 - Prob. 5SICh. 12 - Prob. 6SICh. 12 - Prob. 7SICh. 12 - Prob. 8SI
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- . Prove that the intersection of two context-free languages is not necessarily context-free. This is unlike the case of regular languages which are closed under intersections. Hint: Do something similar to what we did on Activity #21 to show something about two of the languages below and then use what we proved in class about the remaining language. Write several sentences to explain your reasoning. L₁ = {ww has the form a"b"c" for some whole numbers n and m} L2 = {ww has the form amb"c" for some whole numbers n and m} L3 = {w|w has the form a"b"c" for some whole number n}arrow_forwardQuiz Instructions and Question: Show and explain/justify your answer and all the steps used to derive it. This should be a formal proof. Use a proof by construction with generalized state diagrams. 1. Prove that regular languages are closed under the star-closure operation.arrow_forwardAccording to Wikipedia, it makes the language "sweeter" for human use: things can be expressed more clearly, more concisely, or in an alternative style that some may prefer. Out of the list below, which is/are the example(s) of "syntactic sugar" given in class? I. Use of for-loop instead of while-loop to avoid forgetting the counter increment II. If r1 and r2 are Rat objects, we want to write r1 + r2 instead of r1.operator+(r2) III. Use of the "[]" to get to elements of an array IV. Use of *(a+i) instead of a[i]. Answer choices: a.) I + III + IV only b. ) II + IV only c.) I only d.)I + II + III only e.) none f.)II + III only g.)I + II + IV only h.)I + II only i.)II + IV onlyarrow_forward
- Draw NFA for the language L={ anb | n≥5 } defined over Σ={a,b}. Implement it using LEX/FLEX and YACC/BISON. Test it with the strings ab, aaaaab, aabb, aaaaaaab and aaaaaabb. Give the source code and the runtime screen with compilation and execution steps. course name compiler constructionsiarrow_forwardDesign FSMs that will recognise the following languages. Some of these languagesare given simply as sets of strings (and hence there should be no doubt what themachine must recognise). Others are described using English, and there may wellbe a lack of clarity in these descriptions. You should make clear any assumptionsthat you have made in interpreting what the machine needs to do. The alphabetfor all the machines is {x,y, z}.1. {xy, xz}.2. Two x symbols followed by one y and zero or more zs.3. {xxy, xzy, xy}.4. At least one x followed by exactly one y followed by zero or more zs.arrow_forwardExplain and solve step-by-step. Question: Write a Java for loop denotational semantics mapping function. Explain every step!arrow_forward
- For this exercise, we will work on a regular grammar to recognize a comment in a C++ or Java program. A comment starts with /* and ends with */ and anything else in between can be ignored. We won't consider the case of nested comments. Keep in mind that you can have any number of * characters at the beginning, at the end, and in between. • Write a regular grammar recognizing such comments. • Draw the finite state machine for this grammar. • Draw a table for this grammar such as the ones for table-driver scanners in the class notes and in the book.arrow_forwardFill out the table for executing the polynomial-time dynamic programming algorithm for deciding whether the string 1001 is in the context-free language generated by the following CFG. Fill the table completely—do not stop the algorithm early. (Note: This CFG is not quite in Chomsky Normal Form since A appears on the right-hand side of a rule, but the same algorithm still works.) A → BC | CC B → BA | 0 C → AB | BB | 1arrow_forwardWrite a C++ program to implement the LCS algorithm covered in class for finding the Longest Common Subsequence (LCS) of two sequences. Provide comprehensive comments and explanations within your code to elucidate the logic and implementation of the dynamic programming approach. Note that LCS is different from a common substring. Test your program with the following two cases to verify the correctness of your implementation: Test Case 1: Given two sequences X and Y: X= (A, B, C, B, D, A, B) and Y = (B, D, C, A, B, A) Test Case 2: Given two gene sequences S1 and S2: S₁ = ACCGGTCGAGTGCGCGGAAGCCGGCCGAA S₂ = GTCGTTCGGAATGCCGTTGCTCTGTAAAarrow_forward
- Please detailed answer please. Thank you!arrow_forwardAutomata subject? Question: Create R.E for a language defined over Σ={a, b} having even number of a’s and even number of b’s.arrow_forwardCan you describe how the Structured Programming Theorem helps to clarify the GOTO ambiguity and spaghetti code? Write a proper length essay in your own words?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Database System ConceptsComputer ScienceISBN:9780078022159Author:Abraham Silberschatz Professor, Henry F. Korth, S. SudarshanPublisher:McGraw-Hill Education
Starting Out with Python (4th Edition)Computer ScienceISBN:9780134444321Author:Tony GaddisPublisher:PEARSON
Digital Fundamentals (11th Edition)Computer ScienceISBN:9780132737968Author:Thomas L. FloydPublisher:PEARSON
C How to Program (8th Edition)Computer ScienceISBN:9780133976892Author:Paul J. Deitel, Harvey DeitelPublisher:PEARSON
Database Systems: Design, Implementation, & Manag...Computer ScienceISBN:9781337627900Author:Carlos Coronel, Steven MorrisPublisher:Cengage Learning
Programmable Logic ControllersComputer ScienceISBN:9780073373843Author:Frank D. PetruzellaPublisher:McGraw-Hill Education
Database System Concepts
Computer Science
ISBN:9780078022159
Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher:McGraw-Hill Education
Starting Out with Python (4th Edition)
Computer Science
ISBN:9780134444321
Author:Tony Gaddis
Publisher:PEARSON
Digital Fundamentals (11th Edition)
Computer Science
ISBN:9780132737968
Author:Thomas L. Floyd
Publisher:PEARSON
C How to Program (8th Edition)
Computer Science
ISBN:9780133976892
Author:Paul J. Deitel, Harvey Deitel
Publisher:PEARSON
Database Systems: Design, Implementation, & Manag...
Computer Science
ISBN:9781337627900
Author:Carlos Coronel, Steven Morris
Publisher:Cengage Learning
Programmable Logic Controllers
Computer Science
ISBN:9780073373843
Author:Frank D. Petruzella
Publisher:McGraw-Hill Education