
Foundations in Microbiology
9th Edition
ISBN: 9780073522609
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 11.L1, Problem 3CSR
Summary Introduction
To review:
The chain of events involved in transmission of HCV from an infected patient to several other patients.
Introduction:
The detailed investigation of this case led to the findings that there are a series of events that are involved in transmission of HCV from infected patient to other patients.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 11 Solutions
Foundations in Microbiology
Ch. 11.1 - Prob. 1ELOCh. 11.1 - Prob. 2ELOCh. 11.1 - 3. Define and differentiate among the major terms...Ch. 11.1 - 4. Characterize the parameters of microbial death,...Ch. 11.1 - 5. Summarize what factors influence the...Ch. 11.1 - 6. Identify the targets of antimicrobial control...Ch. 11.1 - Prob. 1CYPCh. 11.1 - Prob. 2CYPCh. 11.1 - 3. Contrast various microbes and rate their...Ch. 11.1 - 4. Explain how the types and numbers of...
Ch. 11.1 - Prob. 5CYPCh. 11.1 - Prob. 6CYPCh. 11.1 - Prob. 7CYPCh. 11.1 - Prob. 8CYPCh. 11.1 - Prob. 9CYPCh. 11.2 - Prob. 7ELOCh. 11.2 - Prob. 8ELOCh. 11.2 - Prob. 9ELOCh. 11.2 - 10. Differentiate between thermal death point and...Ch. 11.2 - 11. Describe several moist heat methods and their...Ch. 11.2 - Prob. 12ELOCh. 11.2 - Prob. 13ELOCh. 11.2 - 9. What happens to microbes that encounter...Ch. 11.2 - 10. Summarize the nature, mode of action, and...Ch. 11.2 - 11. Explain the concepts of TDT and TDP, using...Ch. 11.2 - Prob. 13CYPCh. 11.2 - 13. How can the temperature of steam be raised...Ch. 11.2 - Prob. 15CYPCh. 11.2 - Prob. 16CYPCh. 11.2 - 16. Explain why desiccation and cold are not...Ch. 11.3 - Prob. 14ELOCh. 11.3 - 15. Differentiate between ionizing and nonionizing...Ch. 11.3 - Prob. 16ELOCh. 11.3 - Prob. 17ELOCh. 11.3 - Prob. 18CYPCh. 11.3 - Prob. 19CYPCh. 11.3 - 19. What are some advantages and disadvantages of...Ch. 11.3 - Prob. 21CYPCh. 11.3 - Prob. 22CYPCh. 11.4 - Prob. 18ELOCh. 11.4 - 19. Explain the desirable features of...Ch. 11.4 - 20. Describe the types of halogens, their modes of...Ch. 11.4 - 21. Identify the characteristics of phenolic...Ch. 11.4 - 22. Describe the characteristics of oxidizing...Ch. 11.4 - Prob. 23ELOCh. 11.4 - 24. Explain how detergents, soaps, and heavy...Ch. 11.4 - 22. Describe situations that require high-level...Ch. 11.4 - 23. What is the difference between a tincture and...Ch. 11.4 - Name one chemical for which the general rule that...Ch. 11.4 - 24. Define sterilant, and name the principal...Ch. 11.4 - 25. Summarize the chief forms and uses of chlorine...Ch. 11.4 - 26. What are the superior characteristics of...Ch. 11.4 - 27. What are the modes of action of alcohols and...Ch. 11.4 - 28. Why is hydrogen peroxide solution so effective...Ch. 11.4 - 29. Give the uses and disadvantages of the heavy...Ch. 11.4 - 30. What does it mean to say that a chemical has...Ch. 11.L1 - Prob. 1MCQCh. 11.L1 - Prob. 2MCQCh. 11.L1 - Prob. 3MCQCh. 11.L1 - Prob. 4MCQCh. 11.L1 - Prob. 5MCQCh. 11.L1 - Prob. 6MCQCh. 11.L1 - 7. The primary action of ______ heat is to ______....Ch. 11.L1 - Prob. 8MCQCh. 11.L1 - 9. Microbe(s) that is/are the target(s) of...Ch. 11.L1 - 10. Ionizing radiation like _________ removes...Ch. 11.L1 - Prob. 11MCQCh. 11.L1 - Prob. 12MCQCh. 11.L1 - Prob. 13MCQCh. 11.L1 - 14. A chemical with sporicidal properties is a....Ch. 11.L1 - 15. Silver sulfadiazine is used a. in antisepsis...Ch. 11.L1 - Prob. 16MCQCh. 11.L1 - Prob. 17MCQCh. 11.L1 - 1. How would one best describe the state of being...Ch. 11.L1 - Prob. 2CSRCh. 11.L1 - Prob. 3CSRCh. 11.L1 - Prob. 1WCCh. 11.L1 - Prob. 2WCCh. 11.L1 - 4. Think of three situations in which the same...Ch. 11.L1 - 5. Explain what features of endospores make them...Ch. 11.L1 - 6. Explain some of the problems involved in...Ch. 11.L1 - 7. The shelf life and keeping qualities of fruit...Ch. 11.L2 - 1. For each item on the following list, propose a...Ch. 11.L2 - Prob. 2CTCh. 11.L2 - 3. It may seem contradictory that lyophilization...Ch. 11.L2 - 4. A supermarket/drugstore assignment: Look at the...Ch. 11.L2 - 5. Devise an experiment that will differentiate...Ch. 11.L2 - 6. There is quite a bit of concern that chlorine...Ch. 11.L2 - 7. Was the source patient in the case study most...Ch. 11.L2 - Prob. 8CTCh. 11.L2 - From chapter 2, figure 2.20. Study this...Ch. 11.L2 - 2. Explain what is happening with this graph that...
Knowledge Booster
Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningHealth Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:Cengage

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage