Campbell Essential Biology (6th Edition) - standalone book
6th Edition
ISBN: 9780133917789
Author: Eric J. Simon, Jean L. Dickey, Jane B. Reece, Kelly A. Hogan
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11, Problem 4SQ
A eukaryotic gene was inserted into the DNA of a bacterium the bacterium then transcribed this gene into mRNA and translated the mRNA into protein. The protein produced was useless and contained many more amino acids than the protein made by the eukaryotic cell Why?
- a. The mRNA was not spliced as it is in eukaryotes.
- b. Eukaryotes and prokaryotes use different genetic codes.
- c. Repressor proteins interfered with transcription and translation.
- d. Ribosomes were not able to bind to tRNA.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
If eukaryotes have monocistronic genes, why is the number of known proteins more than the number of known genes?
A. Post-translational modification
B. Alternative splicing
C. Base substitution
D. Post-transcriptional modification
A prokaryotic gene was transcribed then translated. During the process,
antibiotics X was added, and the products of translation were only f-met. What
steps in translation was inhibited by antibiotic X?
A. Transpeptidation or the formation of peptide bonds
B. Binding of amino-acyl t-RNA to the 30S subunit of the ribosome
C. Formation of the functional ribosome
D. Translocation or the movement of empty t-RNA to the E site.
E. Hydrolysis of GTP
A scientist studies the production of a key digestive enzyme in silk moths. The moths have one gene for this enzyme, and the scientist extracts mRNA transcribed from this gene as well as protein translated from it. The gene has three introns in its sequence.
If the researcher compares mRNA from inside the nucleus to mRNA from the ribosomes, what will be found?
A.
less mRNA in the nucleus
B.
shorter mRNA in the ribosomes
C.
identical mRNAs in both places
D.
mRNA covalently attached to protein in the nucleus
Chapter 11 Solutions
Campbell Essential Biology (6th Edition) - standalone book
Ch. 11 - Your bore cells, muscle cells, and skin cells look...Ch. 11 - A group of prokaryotic genes with related...Ch. 11 - The regulation of gene expression must be more...Ch. 11 - A eukaryotic gene was inserted into the DNA of a...Ch. 11 - How does DNA packing in chromosomes prevent gene...Ch. 11 - What evidence demonstrates that differentiated...Ch. 11 - The most common procedure for cloning an animal is...Ch. 11 - Prob. 8SQCh. 11 - Prob. 9SQCh. 11 - Prob. 10SQ
Ch. 11 - What is the difference between oncogenes and...Ch. 11 - Prob. 12SQCh. 11 - Prob. 13PSCh. 11 - The human body has a far greater variety of...Ch. 11 - Because a cat must have both orange and non-orange...Ch. 11 - Design a DNA microarray experiment that measures...Ch. 11 - Prob. 17PSCh. 11 - Prob. 18BSCh. 11 - Prob. 19BS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Eukaryotes such as humans have linear chromosomes. In order to signal the end of DNA replication, there is a large repetitive sequence of DNA called a telomere. The telomere region of the DNA signals a process called a. detachment b. termination c. elongation d. transcriptionarrow_forwardWhich sequences are spliced out of the mRNA strand before leaving the nucleus? In other words, which sequences are not part of the code for the amino acids? a. exons b. intronsarrow_forwardWhat is the name of the process that adds a modified guanosine nucleotide to the 5’ phosphates of pre-mRNAs in eukaryotes? a. splicing b. polyadenylation c. capping d. nuclear export e. photophosphorylationarrow_forward
- A scientist is interested in producing flowers with a darker red color. To do this, the scientist alters the promoter of the gene to make it more active. This results in increased transcription and increased red pigments. The scientist then alters the promoter to make it even more active. This results in white flowers with no red pigment. Genetic research showed an increase in the siRNA in the cell. What did the siRNA do to the mRNA? A. The siRNA caused the mRNA to be broken down. B. The siRNA caused alternative splicing of the mRNA. C. The siRNA caused increased methylation of the mRNA. D. The siRNA caused the ribosome to no longer recognize this mRNA.arrow_forwardIn RNA silencing, siRNAs and miRNAs usually bind to which part of the mRNA molecules that they control? a. 5′ UTR b. Coding region c. 3′ poly(A) tail d. 3′ UTRarrow_forwardWhy might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic mRNA? a. If the mutation occurs in the 5' end of the start site, it will not affect the gene product. b. If the mutation occurs in the exon, it will not affect the gene product. c. If the mutation occurs in the splice site of a transcript with alternative splicing, only one gene product may affected. O d. If the mutation occurs in the intron or not in the splice site of a transcript with alternative splicing, it will nc affect the gene product. O e. If the mutation occurs in the 3' end of the start site, it will not affect the gene product. OLIE STIC N 1Aarrow_forward
- With regard to transcriptional termination in eukaryotes, which model suggests that RNA polymerase is physically removed from the DNA? a. Allosteric model b. Torpedo model c. Both models d. Neither modelarrow_forwardA scientist mutates eIF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of eIF-2 alter translation? a. Initiation factors would not be able to bind to mRNA. b. The large ribosomal subunit would not be able to interact with mRNA transcripts. c. tRNAi-Met would not scan mRNA transcripts for the start codon. d. eIF-2 would not be able to interact with the small ribosomal subunit.arrow_forwardSelect the most complete list of correct structures involved in the process of transcription a. mRNA, amino acids, ribosomes, polypeptide chains b. DNA, mRNA, RNA polymerase, a promoter c. mRNA, polypeptide chains, RNA polymerase d. DNA, mRNA, amino acidsarrow_forward
- A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an mRNA transcript contains the codon for this tRNA? A. The tRNA will not bind to this codon. B. Translation stops and the protein is released. C The wrong tRNA is added to the protein chain. D. Translation stops and the protein remains bound to the ribosome.arrow_forwardUse the pre-mRNA sequence shown below to answer the following questions. MRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3' a. Underline the 5' and 3' splice sites, then write the sequence of the spliced mRNA in the space provided. b. Predict what would happen if the G in the 5' splice site were mutated to a C. c. We learned in this topic that the 5' cap in an mRNA plays a role in translation initiation. What do you think is one plausible mechanism by which a 5' cap can enhance initiation ? How can you experimentally demonstrate that a 5' cap is important for this process ?arrow_forwardWhich statement/s is/are TRUE about transcription?A. During transcription, DNA polymerase binds to RNA and separates the DNA strands.B. RNA polymerase uses one strand of DNA as a template to assemble nucleotides into a strand of RNA.C. RNA polymerase binds only to DNA promoters, which have specific base sequences.D. Promoters are signals in RNA that indicate to RNA polymerase where to begin transcription.E. Transcription occurs in the 3’ to 5’ direction with respect to the growing mRNA strand.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY