Campbell Essential Biology (6th Edition) - standalone book
6th Edition
ISBN: 9780133917789
Author: Eric J. Simon, Jean L. Dickey, Jane B. Reece, Kelly A. Hogan
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 11, Problem 2SQ
A group of prokaryotic genes with related functions that are regulated as a single unit, along with the control sequences that perform this regulation, is called a(n) ____.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Identify whether each of the following descriptions applies to typical prokaryotic genomes only,
typical eukaryotic genomes only, both, or neither, according to lecture. Answer options may be used
more than once or not at all.
Composed of double-stranded DNA only.
Each chromosome has a centromere.
Species with larger genomes have more
genes.
[Choose ]
[Choose ]
prokaryotes only
neither eukaryotes or prokaryotes
eukaryotes only
both prokaryotes and eukaryotes
[Choose ]
The following gene sequence of nucleotides is found on the template (non-coding) strand of a molecule of DNA from a bacterial cell. The promoter of the gene is highlighted in bold letters and the +1 is underlined. Use the genetic code at the end of this packet to answer the following questions.
3'-AGGCATATTACGATGCCGGTACTTGATGATGACGGACCCATTATAGGACATATG-5'
a) What is the sequence of the mRNA strand that will be transcribed from this piece of DNA? Indicate which is the 5’ and which is the 3’ end of the mRNA.
b) What is the amino acid sequence that will be translated from this piece of DNA
According to the Central Dogma, genes are the blueprints for making proteins. Each gene (humans have 21,325) contains a single “coded message” of DNA bases (A, T, G, & C) attached in a specific order, which the cell “reads” to create an mRNA molecule that is then translated into protein. Knowing this, EXPLAIN how a SINGLE gene can make different proteins in different cells.
Chapter 11 Solutions
Campbell Essential Biology (6th Edition) - standalone book
Ch. 11 - Your bore cells, muscle cells, and skin cells look...Ch. 11 - A group of prokaryotic genes with related...Ch. 11 - The regulation of gene expression must be more...Ch. 11 - A eukaryotic gene was inserted into the DNA of a...Ch. 11 - How does DNA packing in chromosomes prevent gene...Ch. 11 - What evidence demonstrates that differentiated...Ch. 11 - The most common procedure for cloning an animal is...Ch. 11 - Prob. 8SQCh. 11 - Prob. 9SQCh. 11 - Prob. 10SQ
Ch. 11 - What is the difference between oncogenes and...Ch. 11 - Prob. 12SQCh. 11 - Prob. 13PSCh. 11 - The human body has a far greater variety of...Ch. 11 - Because a cat must have both orange and non-orange...Ch. 11 - Design a DNA microarray experiment that measures...Ch. 11 - Prob. 17PSCh. 11 - Prob. 18BSCh. 11 - Prob. 19BS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the expression “central dogma,” which refers to the flow of genetic information from DNA to RNA to protein. is the word “dogma” appropriate in this context?arrow_forwardProvide a detailed description of gene expression and control in prokaryotes. Provide a detailed description of proteins critical for this process. (please hand draw a figure showing gene expression and control in prokaryotes and the proteins involved)arrow_forwardThe following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold)arrow_forward
- You may wish to consult the genetic code above to answer the following question. A mutation has changed a portion of a protein coding gene that encodes a messenger RNA sequence. The original messenger RNA sequence is 5-AUGCCCAGAGCU-3' Which mutation is a nonsynonymous (missense) mutation that changes a single amino acid in the encoded protein? O 5-AUGCCCAGGGCC-3' O 5'-AUGCCCUGAGCU-3' O 5'-AUGCCCACAGCU-3 5'-AUGCCCCAGAGCU-3arrow_forwardFor each of the following, identify whether that sequence or feature of a typical protein-coding gene would be recognizable in the specified molecule in a typical prokaryotic cell. 5' UTR in DNA? 5' UTR in mRNA? Shine-Dalgarno in DNA? Shine-Dalgarno in polypeptide? Promoter in RNA? Promoter in polypeptide sequence? Stop codon in mRNA? Stop codon in the polypeptide sequence? [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] > <arrow_forwardTranscription is the first step in gene expression. It involves copying a gene's DNA sequence to make an RNA molecule. It is performed by enzymes called RNA polymerases, which link nucleotides to form an RNA strand (using a DNA strand as a template). Transcription has three stages: initiation, elongation, and termination. What is the difference between Rho Dependent and Rho Independent termination in prokaryotes?arrow_forward
- Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?arrow_forwardIn general, why is it important to regulate genes? Discuss examples of situations in which it would be advantageous for a bacterial cell to regulate genes.arrow_forwardTransformation is a process in which bacteria take up new DNA released by dead cells and integrate it into their own genomes (see p. 265 in Chapter 9). In Streptococcus pneumoniae (which causes many cases of pneumonia, inner-ear infections, and meningitis), the ability to carry out transformation requires from 105 to 124 genes, collectively termed the com regulon. The com regulon is activated in response to a protein called competence-stimulating peptide (CSP), which is produced by the bacteria and exported into the surrounding medium. When enough CSP accumulates, it attaches to a receptor on the bacterial cell membrane, which then activates a regulator protein that stimulates the transcription of genes within the com regulon and sets in motion a series of reactions that ultimately result in transformation. Does the com regulon in Streptococcus pneumoniae exhibit positive or negative control? Explain your answer.arrow_forward
- i)Describe a strategy for regulation of transcription in eukaryotes. ii)Explain how this strategy is different than what might be used by a prokaryote.arrow_forwardThe following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. Draw or write-out a) the sequence of the primary transcript and b) the mature mRNA resulting from this stretch of DNA.arrow_forwardDNA within a prokaryotic cell is found in a(n)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY