Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 11, Problem 23P
DNaseI cuts DNA that is not directly associated with nucleosomes. Markus Noll’s treatment of human DNA with DNaseI produced DNA fragments that are consistently about
result would be obtained if nucleosomes were randomly spaced along DNA?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A diploid human cell contains approximately 6.4 billion base pairs of DNA.
Assuming that the linker DNA encompasses 35 bp, how many nucleosomes are present in such a cell? Use two significant figures. How many histone proteins are complexed with this DNA? use two significant figures.
A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.
The ethidium bromide added to the agarose gels intercalates within the base pairs of the DNA double helix as it travels through the gel. Exposure to UV light causes the ethidium bromide to fluoresce, thus allowing for visualization of any DNA. How might this tendency of ethidium bromide to intercalate within the DNA double helix attribute to its carcinogenic properties in living organisms?
Chapter 11 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 11 - Prob. 1PCh. 11 - Prob. 2PCh. 11 - Bacterial DNA is compacted by two principal...Ch. 11 - 10.2 The human genome contains contains base...Ch. 11 - 10.1 Give descriptions for the following...Ch. 11 - 10.4 Describe the importance of light and dark G...Ch. 11 - In eukaryotic DNA, Where are you most likely to...Ch. 11 - Prob. 8PCh. 11 - Human late prophase karyotypes have about 2000...Ch. 11 - 10. What are the two or three most essential...
Ch. 11 - Prob. 11PCh. 11 - Prob. 12PCh. 11 - A researcher interested in studying a human gene...Ch. 11 - Prob. 14PCh. 11 - 10.11 In what way does position effect variegation...Ch. 11 - 16. What are chromosome territories, and what...Ch. 11 - Prob. 17PCh. 11 - Prob. 18PCh. 11 - 10.18 A survey of organisms living deep in the...Ch. 11 - A eukaryote with a diploid number of 2n=6 carries...Ch. 11 - The accompanying chromosome diagram represents a...Ch. 11 - Suppose the genome of a bacterium contains a...Ch. 11 - DNaseI cuts DNA that is not directly associated...Ch. 11 - 10.17 Histone protein isolated from pea plants...Ch. 11 - 25. The molecular probes used in FISH can detect...Ch. 11 - Experimental evidence demonstrates that the...Ch. 11 - Prob. 27PCh. 11 - Genomic DNA from the nematode worm...Ch. 11 - What function do histone proteins perform in...Ch. 11 - Based on discussions of specific proteins and...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In some organisms, UV-induced thymine dimers can be repaired by photoreactivation, in which energy from visible light is used to split the bonds forming the cyclobutane ring ? true or false Non-homologous end joining occurs when enzymes cut out a few nucleotides around a double strand DNA break, and then fuse the ends back together (right) true or false?arrow_forwardSupercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?arrow_forwardLet’s assume the linker region of DNA averages 54 bp in length. How many molecules of H2A would you expect to find in a DNA sample that is 46,000 bp in length?arrow_forward
- The human genome contains about 3 billion base pairs. During the first cell division after fertilization of a human embryo, S phase is approximately three hours long. Assuming an average DNA polymerase rate of 50 nucleotides/second over the entire S phase, what is the minimum number oforigins of replication you would expect to find in the human genome? Show your solution.arrow_forwardOne of the following is a characteristic of eukaryotic genetic material? 1. Eukaryotic genetic material is compacted by wrapping the double-helix around histone proteins to form nucleosomes. 2. Eukaryotic genetic material consists of supercoiled circular DNA molecules complexed with proteins into chromosomes. 3. Eukaryotic genetic material consists of relaxed linear DNA molecules complexed with RNA into a 30 nm fiber. 4. Eukaryotic genetic material is compacted by folding linker regions around non-histone proteins to form a scaffold.arrow_forwardThe human genome contains 3 billion nucleotides arranged in a vast array of sequences. What is the minimum length of a DNA sequence that will, in all probability, appear only once in the human genome? You need consider only one strand and may assume that all four nucleotides have the same probability of appearance.arrow_forward
- Ethanol (CH3-CH2-OH) is miscible in water because it is able to form hydrogen bonds with itself and other molecules. However, its structure only allows it to form 1-2 hydrogen bonds. This is one reason why even low concentrations of ethanol in solution are lethal for cells. Based on this information, explain why we can use high concentrations of ethanol to precipitate DNA out of solution. Also, describe/predict the effects of increasing concentrations of ethanol in (and around) a cell on macro-molecular interactions (i.e. on weak bonds). Finally, it is possible to select for yeast that are tolerant to increased concentrations of ethanol. Give an example of a physiological change in yeast cells that might make them resistant to ethanol.arrow_forwardGive the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?arrow_forwardWhen DNA is heated, it denatures; that is, the strands separate because hydrogen bonds are broken and some base-stacking and hydrophobic interactions are disrupted. The higher the temperature, the larger the number of hydrogen bonds that are broken. After reviewing DNA base pair structure, determine which of the following molecules will denature first as the temperature is raised. Explain your reasoning. a. 5′-GCATTTCGGCGCGTTA-3′ 3′-CGTAAAGCCGCGCAAT-5′ b. 5′-ATTGCGCTTATATGCT-3′ 3′-TAACGCGAATATACGA-5′arrow_forward
- A DNA synthesizer “machine” is used to create short single stranded DNA of any given sequence. You have used the machine to create the following the DNA molecules: (DNA #1) 5’- CTACTACGGATCGGG – 3’ (DNA #2) 5’- CCAGTCCCGATCCGT – 3’ (DNA #3) 5’-AGTAGCCAGTGGGGAAAAACCCCACTGG-3’ Now you add the DNA molecules either singly or in combination to reaction tubes containing DNA polymerase, dATP, dCTP, dGTP, and dTTP in a buffered solution that allows DNA polymerase to function. For each of the reaction tubes, indicate whether DNA polymerase will synthesize any new DNA molecules, and if so, write the sequence(s) of any such DNAs. DNA #1 plus DNA #3 DNA #2 plus DNA #3 DNA #1 plus DNA #2 DNA #3 onlyarrow_forwardConsider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?arrow_forwardSingle-stranded binding proteins (SSBPs) bind to single-stranded DNA at the replication fork and prevent formation of short hairpin sequences that would otherwise impede DNA synthesis. What sorts of sequences in single-stranded DNA might be able to form a hairpin? Write out an example of a sequence that could form a 5-nucleotide hairpin loop, and draw it.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License