Microbiology: A Systems Approach
4th Edition
ISBN: 9780073402437
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 5MCQ
Which of the following sequences, when combined with its complement, could be clipped by an endonuclease?
- a. ATCGATCGTAGCTAGC
- b. AAGCTTTTCGAA
- c. ACCATTGGTA
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
You are studying a protein that contains the peptide sequence
RDGSWKLVI. The part of the DNA encoding this peptide is included
in the sequence shown below.
5'-CGTGACGGCTCGTGGAAGCTAGTCATC-3'
3'-GCACTGCCGAGCACCTTCGATCAGTAG-5'
This sequence does not contain any BamHI restriction enzyme sites.
The target sequence for the BamHI restriction nuclease is GGATCC.
Your goal is to create a BamHI site on this plasmid by manipulating the
DNA sequence, without changing the coding sequence of the protein. How
would you do this, ie what would the new sequence be?
The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene.
123456789
5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3
a. Write the template DNA (complementary strand) sequence for the wild type gene above
b. Write the DNA sequence of the mutant gene (Both DNA strands)
c. Write the sequence of mRNA produced from the mutant gene
d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.
Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA?
Note all sequences are written 5'-3'.
OA. AAGAUCGUCGAUCGGUCAUG
OB. AAGATCGTCGATCGG TCATG
OC. GTACTGGC TAGCTGC TAGAA
OD. GUACUGGCUAGCUGCUAGAA
Chapter 10 Solutions
Microbiology: A Systems Approach
Ch. 10.1 - Provide examples of practical applications of...Ch. 10.2 - Prob. 2AYPCh. 10.2 - Describe how gel electrophoresis is used to...Ch. 10.2 - Prob. 4AYPCh. 10.2 - Prob. 5AYPCh. 10.3 - Prob. 6AYPCh. 10.3 - List examples of genetically modified bacteria,...Ch. 10.4 - Prob. 8AYPCh. 10.4 - Prob. 9AYPCh. 10.5 - Prob. 2CF
Ch. 10.5 - Outline in general terms the process of DNA...Ch. 10.5 - Prob. 11AYPCh. 10.5 - Prob. 12AYPCh. 10.5 - Prob. 13AYPCh. 10.6 - Prob. 14AYPCh. 10 - Prob. 1CFCh. 10 - Which of the following is/are not essential to...Ch. 10 - Prob. 2MCQCh. 10 - The function of ligase is to a. rejoin segments of...Ch. 10 - The creation of biological molecules entirely from...Ch. 10 - Which of the following sequences, when combined...Ch. 10 - A region of DNA in a plasmid that is recognized by...Ch. 10 - Prob. 7MCQCh. 10 - Which of the following is a primary participant in...Ch. 10 - Single nucleotide polymorphisms are found in a....Ch. 10 - Microarrays are used to monitor a. the rate of DNA...Ch. 10 - Prob. 11TFCh. 10 - A nucleic acid probe can be used to identify...Ch. 10 - Prob. 13TFCh. 10 - In order to detect recombinant cells, plasmids...Ch. 10 - Plasmids are the only vectors currently available...Ch. 10 - You are a public health official trying to...Ch. 10 - a.Construct a strand of complementary DNA (cDNA)...Ch. 10 - Prob. 3CTQCh. 10 - Prob. 4CTQCh. 10 - Prob. 5CTQCh. 10 - Prob. 6CTQCh. 10 - a.Define the term RFLP. Explain how RFLPs are...Ch. 10 - Prob. 8CTQCh. 10 - Prob. 9CTQCh. 10 - Prob. 10CTQCh. 10 - Prob. 1CCCh. 10 - Prob. 2CCCh. 10 - Prob. 3CCCh. 10 - Prob. 4CCCh. 10 - From chapter 6, figure 6.19. What has happened to...Ch. 10 - Prob. 2VCCh. 10 - Using the words that follow, please create a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- List the sequences of RNA that would be transcribed from the following DNA template sequences. TTACACTTGCTTGAGAGTC ACTTGGGCTATGCTCATTA GGCTGCAATAGCCGTAGAT GGAATACGTCTAGCTAGCAarrow_forwardBased on the sequence data in the figure above, would you consider the patient to be not affected, affected or a carrier? What type of mutation occurred in exon 13?arrow_forwardWhich of the following represents the sequence of an RNA transcript for which the template strand of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. DA. GUACUGGCUAGCUGCUAGAA B. UUCUAGCAGCUAGCCAGUAC с. ТТСТАGCAGCTAGCCAGTАС D. GTACTGGCТAGCTGCTAGAАarrow_forward
- The following gene sequence of nucleotides is found on the template (non-coding) strand of a molecule of DNA from a bacterial cell. The promoter of the gene is highlighted in bold letters and the +1 is underlined. Use the genetic code at the end of this packet to answer the following questions. 3'-AGGCATATTACGATGCCGGTACTTGATGATGACGGACCCATTATAGGACATATG-5' a) What is the sequence of the mRNA strand that will be transcribed from this piece of DNA? Indicate which is the 5’ and which is the 3’ end of the mRNA. b) What is the amino acid sequence that will be translated from this piece of DNAarrow_forwardBelow is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?arrow_forwardWhich of these choices represents one possible corresponding mRNA sequence that can be transcribed from the following DNA template? 5′ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3′arrow_forward
- The following is a section of the gene coding for bovine rhodopsin along with several restriction endonucleases, their recognition sequences, and their hydrolysis sites. Which endonucleases will catalyze cleavage of this section of DNA? 5-GCCGTCTACAАСССGGTCATCTAАСТАТСАТGATCААСАAGCAGTTCCGGAACT-3' Recognition Sequence Recognition Sequence Enzyme Enzyme AG | CT TGG | CCA CG I CG GG | CC CI CGG | GATC GC | GGCCGC GAGCT | C Alul Hpall Ball Mbol FnuDII NotI HealII Sadarrow_forwardThe sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide highlighted by the arrow. If the upper strand shown is the template strand, write the sequence you expect for the mRNA transcribed from this gene. Please write 5' to 3'. 5'-[x]-3' 5'-TACGTGACGGTAATACTAGC-3' 3'-ATGCACTGCCATTATGATCG-5'arrow_forwardPlease write the sequence of the mRNA transcript transcribed from the given DNA double helix by indicating template and non template strands.(SLO1)5’-ACGGCATGCATGGTTTAAAAGGGGCCCAAAA-3’3’-TGCCGTACGTACCAAATTTTCCCCGGGTTTT-5’arrow_forward
- Why would you NOT expect a restriction endonuclease to exist that would recognize the site AAGGAA?arrow_forwardThe BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINYarrow_forwardThe following bacterial DNA sequence uses the top strand as the coding strand and the bottom strand as the template strand. Write what the messenger RNA sequence for this gene would be after transcription occurs.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY