The way in which DNA from the victims of the WTC attacks analyzed. Introduction After the terrorist attack on the World Trade Center on 9 November 2011, the victims were not identified. In September 2011, around 1,632 victims were identified, and around 1,121 were not identified. Thus, researchers discovered a DNA profiling method to determine the identity of the victims. As this method helped the people to find their family members on the basis of DNA match/genetic similarities.

Question

Want to see more full solutions like this?

Answer 1

Question

Chapter 10, Problem 1CF

Summary Introduction

To determine:

The way in which DNA from the victims of the WTC attacks analyzed.

Introduction

After the terrorist attack on the World Trade Center on 9 November 2011, the victims were not identified. In September 2011, around 1,632 victims were identified, and around 1,121 were not identified. Thus, researchers discovered a DNA profiling method to determine the identity of the victims. As this method helped the people to find their family members on the basis of DNA match/genetic similarities.

Expert Solution

Explanation of Solution

After the terrorist attack on WTC, most of the victims were not identified. To identify the victims, researchers discovered the DNA profiling method. They start collecting DNA sample from the attack site and identified half of the victims. To prevent the fire arise from the explosion cause the degradation of remaining DNA, and making the DNA extraction process more difficult.

Victim’s relatives start providing their DNA sample to newly developed Mass Disaster Kinship Analysis Program (MDKAP). These donated DNA samples were used to identify the victims or lost family member. These donated DNA samples were used to form a database which helps in the identification of lost family members. Forensic scientists used this database, and scan the MDKAP database for genetic similarities. Through a DNA profiling method, it was easy to identify the victims.

Conclusion

The DNA profiling technique helps in the identification of WTC victim’s.

Summary Introduction

To determine:

The improvements to this technology have been made in the past decade to accurately identify the victims.

Introduction

After the terrorist attack on the World Trade Center on 9 November 2011, still, the victims were not identified. In September 2011, around 1,632 victims were identified, and around 1,121 were not identified. Thus, researchers discovered a DNA profiling method to determine the identity of the victims. As this method helped the people to find their family members on the basis of DNA match/genetic similarities.

Expert Solution

Explanation of Solution

After the terrorist attack on WTC, most of the victims were not identified. To identify the victims, researchers discovered the DNA profiling method. They start collecting the DNA sample from the attack site and identified half of the victims. To accurately identify the victims, scientists have developed MDKAP camp. This camp helps scientist to create a database which is used to identify the victims. The task for the identification of WTC attack victims spiked DNA analysis. This innovation of DNA analysis has been helpful in identifying the other missing persons or war casualties.

The DNA sample which is collected from the site later subjected to PCR, or STRs (short tandem repeats), which amplified the short segment of DNA. The amplified DNA segments then compared to the database. The matching of the amplified segment to the database would help in the accurate identification of a victim.

Conclusion

The task for identification of WTC attack’s victims, a scientist has spurred innovation of DNA analysis.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

What is amplification bias?

Answer 2

Question

Chapter 10, Problem 1CF

Summary Introduction

To determine:

The way in which DNA from the victims of the WTC attacks analyzed.

Introduction

After the terrorist attack on the World Trade Center on 9 November 2011, the victims were not identified. In September 2011, around 1,632 victims were identified, and around 1,121 were not identified. Thus, researchers discovered a DNA profiling method to determine the identity of the victims. As this method helped the people to find their family members on the basis of DNA match/genetic similarities.

Expert Solution

Explanation of Solution

After the terrorist attack on WTC, most of the victims were not identified. To identify the victims, researchers discovered the DNA profiling method. They start collecting DNA sample from the attack site and identified half of the victims. To prevent the fire arise from the explosion cause the degradation of remaining DNA, and making the DNA extraction process more difficult.

Victim’s relatives start providing their DNA sample to newly developed Mass Disaster Kinship Analysis Program (MDKAP). These donated DNA samples were used to identify the victims or lost family member. These donated DNA samples were used to form a database which helps in the identification of lost family members. Forensic scientists used this database, and scan the MDKAP database for genetic similarities. Through a DNA profiling method, it was easy to identify the victims.

Conclusion

The DNA profiling technique helps in the identification of WTC victim’s.

Summary Introduction

To determine:

The improvements to this technology have been made in the past decade to accurately identify the victims.

Introduction

After the terrorist attack on the World Trade Center on 9 November 2011, still, the victims were not identified. In September 2011, around 1,632 victims were identified, and around 1,121 were not identified. Thus, researchers discovered a DNA profiling method to determine the identity of the victims. As this method helped the people to find their family members on the basis of DNA match/genetic similarities.

Expert Solution

Explanation of Solution

After the terrorist attack on WTC, most of the victims were not identified. To identify the victims, researchers discovered the DNA profiling method. They start collecting the DNA sample from the attack site and identified half of the victims. To accurately identify the victims, scientists have developed MDKAP camp. This camp helps scientist to create a database which is used to identify the victims. The task for the identification of WTC attack victims spiked DNA analysis. This innovation of DNA analysis has been helpful in identifying the other missing persons or war casualties.

The DNA sample which is collected from the site later subjected to PCR, or STRs (short tandem repeats), which amplified the short segment of DNA. The amplified DNA segments then compared to the database. The matching of the amplified segment to the database would help in the accurate identification of a victim.

Conclusion

The task for identification of WTC attack’s victims, a scientist has spurred innovation of DNA analysis.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Question

Chapter 10, Problem 1CF

Summary Introduction

To determine:

The way in which DNA from the victims of the WTC attacks analyzed.

Introduction

After the terrorist attack on the World Trade Center on 9 November 2011, the victims were not identified. In September 2011, around 1,632 victims were identified, and around 1,121 were not identified. Thus, researchers discovered a DNA profiling method to determine the identity of the victims. As this method helped the people to find their family members on the basis of DNA match/genetic similarities.

Expert Solution

Explanation of Solution

After the terrorist attack on WTC, most of the victims were not identified. To identify the victims, researchers discovered the DNA profiling method. They start collecting DNA sample from the attack site and identified half of the victims. To prevent the fire arise from the explosion cause the degradation of remaining DNA, and making the DNA extraction process more difficult.

Victim’s relatives start providing their DNA sample to newly developed Mass Disaster Kinship Analysis Program (MDKAP). These donated DNA samples were used to identify the victims or lost family member. These donated DNA samples were used to form a database which helps in the identification of lost family members. Forensic scientists used this database, and scan the MDKAP database for genetic similarities. Through a DNA profiling method, it was easy to identify the victims.

Conclusion

The DNA profiling technique helps in the identification of WTC victim’s.

Summary Introduction

To determine:

The improvements to this technology have been made in the past decade to accurately identify the victims.

Introduction

After the terrorist attack on the World Trade Center on 9 November 2011, still, the victims were not identified. In September 2011, around 1,632 victims were identified, and around 1,121 were not identified. Thus, researchers discovered a DNA profiling method to determine the identity of the victims. As this method helped the people to find their family members on the basis of DNA match/genetic similarities.

Expert Solution

Explanation of Solution

After the terrorist attack on WTC, most of the victims were not identified. To identify the victims, researchers discovered the DNA profiling method. They start collecting the DNA sample from the attack site and identified half of the victims. To accurately identify the victims, scientists have developed MDKAP camp. This camp helps scientist to create a database which is used to identify the victims. The task for the identification of WTC attack victims spiked DNA analysis. This innovation of DNA analysis has been helpful in identifying the other missing persons or war casualties.

The DNA sample which is collected from the site later subjected to PCR, or STRs (short tandem repeats), which amplified the short segment of DNA. The amplified DNA segments then compared to the database. The matching of the amplified segment to the database would help in the accurate identification of a victim.

Conclusion

The task for identification of WTC attack’s victims, a scientist has spurred innovation of DNA analysis.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Question

Chapter 10, Problem 1CF

Summary Introduction

To determine:

The way in which DNA from the victims of the WTC attacks analyzed.

Introduction

After the terrorist attack on the World Trade Center on 9 November 2011, the victims were not identified. In September 2011, around 1,632 victims were identified, and around 1,121 were not identified. Thus, researchers discovered a DNA profiling method to determine the identity of the victims. As this method helped the people to find their family members on the basis of DNA match/genetic similarities.

Expert Solution

Explanation of Solution

After the terrorist attack on WTC, most of the victims were not identified. To identify the victims, researchers discovered the DNA profiling method. They start collecting DNA sample from the attack site and identified half of the victims. To prevent the fire arise from the explosion cause the degradation of remaining DNA, and making the DNA extraction process more difficult.

Victim’s relatives start providing their DNA sample to newly developed Mass Disaster Kinship Analysis Program (MDKAP). These donated DNA samples were used to identify the victims or lost family member. These donated DNA samples were used to form a database which helps in the identification of lost family members. Forensic scientists used this database, and scan the MDKAP database for genetic similarities. Through a DNA profiling method, it was easy to identify the victims.

Conclusion

The DNA profiling technique helps in the identification of WTC victim’s.

Summary Introduction

To determine:

The improvements to this technology have been made in the past decade to accurately identify the victims.

Introduction

After the terrorist attack on the World Trade Center on 9 November 2011, still, the victims were not identified. In September 2011, around 1,632 victims were identified, and around 1,121 were not identified. Thus, researchers discovered a DNA profiling method to determine the identity of the victims. As this method helped the people to find their family members on the basis of DNA match/genetic similarities.

Expert Solution

Explanation of Solution

After the terrorist attack on WTC, most of the victims were not identified. To identify the victims, researchers discovered the DNA profiling method. They start collecting the DNA sample from the attack site and identified half of the victims. To accurately identify the victims, scientists have developed MDKAP camp. This camp helps scientist to create a database which is used to identify the victims. The task for the identification of WTC attack victims spiked DNA analysis. This innovation of DNA analysis has been helpful in identifying the other missing persons or war casualties.

The DNA sample which is collected from the site later subjected to PCR, or STRs (short tandem repeats), which amplified the short segment of DNA. The amplified DNA segments then compared to the database. The matching of the amplified segment to the database would help in the accurate identification of a victim.

Conclusion

The task for identification of WTC attack’s victims, a scientist has spurred innovation of DNA analysis.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Chapter 10, Problem 1CF

Summary Introduction

To determine:

The way in which DNA from the victims of the WTC attacks analyzed.

Introduction

After the terrorist attack on the World Trade Center on 9 November 2011, the victims were not identified. In September 2011, around 1,632 victims were identified, and around 1,121 were not identified. Thus, researchers discovered a DNA profiling method to determine the identity of the victims. As this method helped the people to find their family members on the basis of DNA match/genetic similarities.

Expert Solution

Explanation of Solution

After the terrorist attack on WTC, most of the victims were not identified. To identify the victims, researchers discovered the DNA profiling method. They start collecting DNA sample from the attack site and identified half of the victims. To prevent the fire arise from the explosion cause the degradation of remaining DNA, and making the DNA extraction process more difficult.

Victim’s relatives start providing their DNA sample to newly developed Mass Disaster Kinship Analysis Program (MDKAP). These donated DNA samples were used to identify the victims or lost family member. These donated DNA samples were used to form a database which helps in the identification of lost family members. Forensic scientists used this database, and scan the MDKAP database for genetic similarities. Through a DNA profiling method, it was easy to identify the victims.

Conclusion

The DNA profiling technique helps in the identification of WTC victim’s.

Summary Introduction

To determine:

The improvements to this technology have been made in the past decade to accurately identify the victims.

Introduction

After the terrorist attack on the World Trade Center on 9 November 2011, still, the victims were not identified. In September 2011, around 1,632 victims were identified, and around 1,121 were not identified. Thus, researchers discovered a DNA profiling method to determine the identity of the victims. As this method helped the people to find their family members on the basis of DNA match/genetic similarities.

Expert Solution

Explanation of Solution

After the terrorist attack on WTC, most of the victims were not identified. To identify the victims, researchers discovered the DNA profiling method. They start collecting the DNA sample from the attack site and identified half of the victims. To accurately identify the victims, scientists have developed MDKAP camp. This camp helps scientist to create a database which is used to identify the victims. The task for the identification of WTC attack victims spiked DNA analysis. This innovation of DNA analysis has been helpful in identifying the other missing persons or war casualties.

The DNA sample which is collected from the site later subjected to PCR, or STRs (short tandem repeats), which amplified the short segment of DNA. The amplified DNA segments then compared to the database. The matching of the amplified segment to the database would help in the accurate identification of a victim.

Conclusion

The task for identification of WTC attack’s victims, a scientist has spurred innovation of DNA analysis.

Answer 6

Chapter 10, Problem 1CF

Summary Introduction

To determine:

The way in which DNA from the victims of the WTC attacks analyzed.

Introduction

After the terrorist attack on the World Trade Center on 9 November 2011, the victims were not identified. In September 2011, around 1,632 victims were identified, and around 1,121 were not identified. Thus, researchers discovered a DNA profiling method to determine the identity of the victims. As this method helped the people to find their family members on the basis of DNA match/genetic similarities.

Expert Solution

Explanation of Solution

After the terrorist attack on WTC, most of the victims were not identified. To identify the victims, researchers discovered the DNA profiling method. They start collecting DNA sample from the attack site and identified half of the victims. To prevent the fire arise from the explosion cause the degradation of remaining DNA, and making the DNA extraction process more difficult.

Victim’s relatives start providing their DNA sample to newly developed Mass Disaster Kinship Analysis Program (MDKAP). These donated DNA samples were used to identify the victims or lost family member. These donated DNA samples were used to form a database which helps in the identification of lost family members. Forensic scientists used this database, and scan the MDKAP database for genetic similarities. Through a DNA profiling method, it was easy to identify the victims.

Conclusion

The DNA profiling technique helps in the identification of WTC victim’s.

Answer 7

Chapter 10, Problem 1CF

Summary Introduction

To determine:

The way in which DNA from the victims of the WTC attacks analyzed.

Introduction

After the terrorist attack on the World Trade Center on 9 November 2011, the victims were not identified. In September 2011, around 1,632 victims were identified, and around 1,121 were not identified. Thus, researchers discovered a DNA profiling method to determine the identity of the victims. As this method helped the people to find their family members on the basis of DNA match/genetic similarities.

Answer 8

Expert Solution

Explanation of Solution

After the terrorist attack on WTC, most of the victims were not identified. To identify the victims, researchers discovered the DNA profiling method. They start collecting DNA sample from the attack site and identified half of the victims. To prevent the fire arise from the explosion cause the degradation of remaining DNA, and making the DNA extraction process more difficult.

Victim’s relatives start providing their DNA sample to newly developed Mass Disaster Kinship Analysis Program (MDKAP). These donated DNA samples were used to identify the victims or lost family member. These donated DNA samples were used to form a database which helps in the identification of lost family members. Forensic scientists used this database, and scan the MDKAP database for genetic similarities. Through a DNA profiling method, it was easy to identify the victims.

Answer 9

Expert Solution

Answer 10

Expert Solution

Answer 11

Expert Solution

Answer 12

Conclusion

The DNA profiling technique helps in the identification of WTC victim’s.

Answer 13

Summary Introduction

To determine:

The improvements to this technology have been made in the past decade to accurately identify the victims.

Introduction

After the terrorist attack on the World Trade Center on 9 November 2011, still, the victims were not identified. In September 2011, around 1,632 victims were identified, and around 1,121 were not identified. Thus, researchers discovered a DNA profiling method to determine the identity of the victims. As this method helped the people to find their family members on the basis of DNA match/genetic similarities.

Expert Solution

Explanation of Solution

After the terrorist attack on WTC, most of the victims were not identified. To identify the victims, researchers discovered the DNA profiling method. They start collecting the DNA sample from the attack site and identified half of the victims. To accurately identify the victims, scientists have developed MDKAP camp. This camp helps scientist to create a database which is used to identify the victims. The task for the identification of WTC attack victims spiked DNA analysis. This innovation of DNA analysis has been helpful in identifying the other missing persons or war casualties.

The DNA sample which is collected from the site later subjected to PCR, or STRs (short tandem repeats), which amplified the short segment of DNA. The amplified DNA segments then compared to the database. The matching of the amplified segment to the database would help in the accurate identification of a victim.

Conclusion

The task for identification of WTC attack’s victims, a scientist has spurred innovation of DNA analysis.

Answer 14

Summary Introduction

To determine:

The improvements to this technology have been made in the past decade to accurately identify the victims.

Introduction

After the terrorist attack on the World Trade Center on 9 November 2011, still, the victims were not identified. In September 2011, around 1,632 victims were identified, and around 1,121 were not identified. Thus, researchers discovered a DNA profiling method to determine the identity of the victims. As this method helped the people to find their family members on the basis of DNA match/genetic similarities.

Answer 15

Expert Solution

Explanation of Solution

After the terrorist attack on WTC, most of the victims were not identified. To identify the victims, researchers discovered the DNA profiling method. They start collecting the DNA sample from the attack site and identified half of the victims. To accurately identify the victims, scientists have developed MDKAP camp. This camp helps scientist to create a database which is used to identify the victims. The task for the identification of WTC attack victims spiked DNA analysis. This innovation of DNA analysis has been helpful in identifying the other missing persons or war casualties.

The DNA sample which is collected from the site later subjected to PCR, or STRs (short tandem repeats), which amplified the short segment of DNA. The amplified DNA segments then compared to the database. The matching of the amplified segment to the database would help in the accurate identification of a victim.