
(1)
To explain:
The aspects of DNA structure which provide stability to the molecule upto thousands of years.
Introduction:
The stability of DNA is dependent on various features and structural composition of DNA. The intermolecular interactions, double helical structure base stacking, and surrounding water play a major role in the stability of DNA.
(1)

Explanation of Solution
The DNA is a
1. The structural and chemical stability of DNA comes from the linkage between
2. Base stacking is a major reason of DNA stability. Two polynucleotide strands are attached to one another in the form of stack because of the complementary nature of nucleotide bases.
3. Hydrogen bonds are found between two successive nucleotides, though hydrogen bonds are weak bonds, but large amount of bonds present on two strands of DNA make its chemical and structural condition stable.
4. The nitrogenous bases are complementary to each other so, nitrogenous bases present on two separate strands get bind strongly and form double helical structure of DNA to make it stable.
5. Lacking a hydroxyl group at 2nd carbon also provide stability to DNA; hydroxyl group tends to react fast. The ribose sugar of DNA contains only one hydroxyl group at 5th position which is engaged in the formation of phosphodiester bonds with phosphate group. The absence of spare hydroxyl groups provides immunity to DNA towards several
(2)
To explain:
The stability of RNA is less in comparison to DNA.
Introduction:
RNA is a polynucleotide and it is the genetic material of various viruses. RNA and DNA are different from each other in composition as well as in the structure. RNA is less stable than DNA due to these structural and compositional differences.
(2)

Explanation of Solution
The reasons of RNA being less stable than DNA are:
1. RNA is single stranded while DNA is a double stranded helical structure. The double helical structure of DNA is rich in hydrogen bonds, being single stranded, RNA does not possess large number of hydrogen bonding. Large number of hydrogen bonds need high amount of energy to break the bonds.
2. Presence of hydroxyl group on the 2nd carbon of ribose sugar of RNA makes it less stable than DNA, as hydroxyl group is very reactive and can undergo hydrolysis easily.
3. In RNA, uracil is found in the place of thymine, thymine contains a methyl group which supports the repairing of damaged DNA. Uracil is formed by the deamination of cytosine. The rapid deamination of cytosine will decrease guanine and cytosine base pairing.
DNA is a stable molecule due to the presence of large number of hydrogen bonds, complementary nitrogenous bases present on two separate strands form hydrogen bonds and provide a double helical structure to DNA, absence of hydroxyl group in the sugar part of DNA prevents it from hydrolysis, base stacking also plays a major role in the DNA stability. RNA is less stable than DNA because of being single stranded and the presence of hydroxyl group on the 2nd carbon of sugar makes it susceptible tohydrolysis. Presence of uracil in the place of thymine is a disadvantage of RNA.
Want to see more full solutions like this?
Chapter 10 Solutions
Genetics: A Conceptual Approach 6E w/ SaplingPlus (Six-Month Access)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





