You have used the primer 5' CTGA 3' in a DNA sequencing reaction with the template DNA sequence shown below. DNTPS, DNA polymerase and ddCTP were also added. Write out the sequence of 4 DNA fragments you expect to produce in your sequencing reaction. Include the 5' and 3' ends of each fragment in your answer.

You have used the primer 5' CTGA 3' in a DNA sequencing reaction with the template DNA sequence shown below. DNTPS, DNA polymerase and ddCTP were also added. Write out the sequence of 4 DNA fragments you expect to produce in your sequencing reaction. Include the 5' and 3' ends of each fragment in your answer.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

In the drawing shown below, the top strand (purple) is the template DNA, and the bottom shows the synthesis of the lagging strand (DNA in blue and RNA primers in red). 3' 5" ыш Left Okazaki fragment --- -11-- Middle Okazaki fragment Right Okazaki fragment 5' 3' After DNA polymerase I removes the middle primer and fills in with DNA, where is DNA ligase needed? See the arrows on both sides of the middle primer. Explain whether ligase is needed at the left arrow, at the right arrow, or both?
Assume complete digestion of a single linear piece of DNA digested (cut) with EcoRI and Hindill. Assume complete digestion of the plasmid digested with Eco and HindIll. What comes out of the plasmid when you digest with EcoRl and Hindill? What could ligate into the plasmid during ligation! Need help answering these questions
How would I calculate sanger sequencing fragments that will produce green
Following base removal, DNA polymerase can add nucleotides in the 5'-to-3' direction. Is that true or False? Why? please help me explain that
The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?
Restriction endonucleases are bacterial enzymes that cleave duplex (double-stranded) DNA at specific nucleotide sequences. The mode of replication of the animal virus SV40 has been investigated by using restriction endonucleases that cleave SV40 DNA into a number of unique segments. Like most viruses, SV40 DNA is circular. The map positions of the 11 fragments produced by a pair of restriction endonucleases are shown on the next page. Immediately following a 5 or 10 minute pulse of radioactively labeled thymidine, labeled SV40 molecules that have completed replication during the pulse are isolated. These newly replicated DNA molecules are digested by the restriction endonucleases and the resulting fragments are analyzed for the relative amounts of pulse label they contain. The results are in the table below. Assume that at the time the label was added there was a random population of replicating SV40 DNA molecules in all possible stages of synthesis. From the information given below,…