You are an expert molecular biologist and you just had your regular PCR run and you are now checking your PCR products if you have amplified the correct desired DNA fragment. Upon checking the results of the electrophoresis, you noticed that you have several bands in your gel. You expected that you will only have a band with the same size as with the "X" size of the DNA ladder. Unfortunately, you have also seen bands that fall in the "W", "Y" and "Z" markers of the ladder. Assume you got a very high quality DNA template from your extraction step. B. What are the steps you will make to be able to avoid this in your next PCR run?

You are an expert molecular biologist and you just had your regular PCR run and you are now checking your PCR products if you have amplified the correct desired DNA fragment. Upon checking the results of the electrophoresis, you noticed that you have several bands in your gel. You expected that you will only have a band with the same size as with the "X" size of the DNA ladder. Unfortunately, you have also seen bands that fall in the "W", "Y" and "Z" markers of the ladder. Assume you got a very high quality DNA template from your extraction step. B. What are the steps you will make to be able to avoid this in your next PCR run?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 1ITD: You learned in the chapter that an STR locus is a locus where alleles differ in the number of copies...

See similar textbooks

Similar questions

You are an expert molecular biologist and you just had your regular PCR run and you are now checking your PCR products if you have amplified the correct desired DNA fragment. Upon checking the results of the electrophoresis, you noticed that you have several bands in your gel. You expected that you will only have a band with the same size as with the "X" size of the DNA ladder. Unfortunately, you have also seen bands that fall in the "W", "Y" and "Z" markers of the ladder. Assume you got a very high quality DNA template from your extraction step. A. What do you think are the possible causes of this incident? Explain briefly.
You are performing PCR for the first time using some new primers that are 25 nucleotides in length with an estimated melting temperature of 65 0C to amplify a 200 nucleotide gene. After PCR, you run an agarose gel on the samples and observe a faint band at 25 nucleotides. What is the best possible explanation for the results? The primers hybridized to multiple sites on the DNA template. Too much template DNA was added to the PCR mixture. The primers dimerized preventing DNA transcription from occurring. A nuclease was in the solution causing degradation of the DNA.
You have two tubes, each with a pair of DNA fragments inside them. Tube #1 has fragments that are 500bp and 1000 bp in length. Tube #2 has fragments that are 7500bp and 8000bp in size. If you were to perform agarose gel electrophoresis and run the contents of each tube in two separate lanes on the same gel, what would you expect to see? O That the difference between the distances migrated by the two fragments in Tube #1 was much greater than the difference between the distances migrated by the two fragments in Tube #2. O That the difference between the distances migrated by the two fragments in Tube #1 was the same as difference between the distances migrated by the two fragments in Tube #2. O That the difference between the distances migrated by the two fragments in Tube #1 was much less than the difference between the distances migrated by the two fragments in Tube #2. O It is not possible to estimate what we would expect to see.
Your graduate advisor asks you to amplify the following sequence of DNA by PCR: 5’-ATACGCATTCGGACCAGGTCCTAA-3’ 3’-TATGCGTAAGCCTGGTCCAGGATT-5’ a. To ensure that the entire sequence above is amplified, what 6-nucleotide DNA primers should you add to your PCR mix? You order the primers listed above, but instead receive the following set of primers: 5’-CGCATT-3’ 5’-GGACCT-3’ b. What portion of the double stranded DNA molecule will be amplified after 10 rounds of PCR? Your labmate attempts to rescue your PCR reaction by providing you with the following set of primers: 5’-ATACGC-3’ 5’-TCCTAA-3’ c. What is the result of running the PCR reaction with your labmate’s primers? How many double stranded molecules of DNA will result from 10 rounds of amplification?
Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TTGCATCG 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA, and will this primer work as part of a pair to successfully amplify this fragment of DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. It will bind to the bottom strand on the left side of the fragment, and is suitable to amplify the fragment by PCR. b. It will bind to the top strand on the left side of the fragment, but it is unsuitable to amplify the fragment by PCR. c. It will bind to the top strand on the right side of the fragment, but it is unsuitable to amplify the fragment by PCR. d. It will bind to the bottom strand on the right side of the…
For the STR site diagramed below, each repeat unit, represented by a rectangle, is known to be 5 bp long. The total length of the amplified PCR product for the chromosome shown below is 420 bp long. PCR product - 420 bo Primer Left STR STR STR STR Primer Right What size would the PCR product be for a different chromosome where there were only two tandem repeat units, instead of four? SHOW YOUR WORK.
An investigator has a strand of chromosomal DNA whose sequence is shown. She wants to use polymerase chain reaction (PCR) to amplify and isolate the DNA fragment defined by the highlighted segment. Her first step is to design two PCR primers, each 20 nucleotides long, that can be used to amplify this DNA segment. The final PCR product generated from the primers should include no sequences outside of the highlighted segment. 5'--- AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG TTAGATTGATTGTTAGGTTCTTAGGTTTAGGTTCTGGTATT GGTTTAGGGTCTTTGATGCTATTAATTCTTTGGTTTTGATTT GGTCTTTATATGGTTTATGTTTTAAGCCGGGTTTTGTCTGG- GATGGTTCGTCTGATGTGCGCGTAGCGTGCGGCG---3' What are the sequences of the investigator's forward and reverse primer? Enter them 5' to 3'. forward primer: reverse primer: GGAGCTCAGTTAGCTACGAC Incorrect CGCCGCACGCTA - Incorrect
You wish to amplify a segment of DNA from a plasmid template by PCR with the use of the following primers: 5’-GGATCGATGCTCGCGA3' and 5' -AGGATCGGGTCGCGAG-3'. Despite repeated attempts, you fail to observe a PCR product of the expected length after electrophoresis on an agarose gel. Instead, you observe a bright smear on the gel with an approximate length of 25 to 30 base pairs. Explain these results.
You have two PCR primers: Forward- 5' TGAGCTAGGC 3' and Reverse- 5' GGTTCAGTCAG 3'. Show the binding sites of the primers to their Double strand DNA template. As the primer sizes are 10 and 11 bp, just write a 30 bp double stranded DNA (making sure the 5' and 3' ends of the double strand DNA in all 4 ends) and show where in the 30 bp double stranded DNA, these two primers would bind in correct orientation.
The figure below represents two DNA molecules, with polarities as indicated. The dashed block shows the region of DNA which you wish to amplify by PCR. In each case, indicate the positions of the forward and reverse primers you would use for the PCR, their polarities, and the direction of synthesis of the new strands with an arrow at the end of the primer. 5' 3' ------------------- 3' 3' 5' 5' ------------------------------ 5' 3'
To prepare a sample for electrophoresis, samples of the DNA being investigated (a) are put into each of four tubes and induced to replicate (b). Also, into the first tube, an adenine terminator was added in addition to all the other nucleotides. As the complementary strand was being constructed, the terminators were occasionally incorporated wherever an adenine nucleotide was used. This random incorporation resulted in all possible lengths of DNA pieces that had an adenine on the end (c). The same process was conducted in the other tubes with thymine, guanine and cytosine terminators; one treatment for each of the four lanes in the gel. Electrophoresis separated the replicated pieces of DNA by size. Staining the gel revealed which lengths of the complementary DNA were terminated by which nucleotide terminators (d). The gel consists of four “lanes,” labeled A, T, G, and C, indicating either adenine, thymine, guanine, or cytosine terminated pieces of DNA. By “reading” down the gel, you…
After you design the PCR primers, you run the PCR on fluid from the patient’s nasal swab. Next, you need to evaluate the results. PCR makes billions of copies of just one sequence in a sample. Since you know the sequence, you also know the length (number of nucleotides) of the region you copied. There are about 130 nucleotides in the N gene fragment. This is typically stated as 130 base pairs. How can you visualize DNA and estimate its size? Load the DNA sample into an agarose gel (similar in consistency to jello) and apply an electric current to the gel. The DNA is charged and will move through the gel. The longer the DNA fragment, the more slowly it moves. The DNA is visualized by adding a fluorescent dye to your sample that sticks to DNA. When you look at the gel under UV light, the DNA should glow. What is the charge of a DNA molecule? Based on #1, would you expect DNA to be drawn to the (+) or (-) electrode of the gel electrophoresis chamber?