Write notes on RAPD, microsatellites DNA, AFLP.
Q: How do you do this? can you explain and show me? Replication Given Original DNA strand: ATCCTAGCC.…
A: Replication is the process by which a double stranded DNA molecule is copied to produce to identical…
Q: What part of the genome is used for a genetic fingerprint? A Introns Ministe OC. Chromosomes OD…
A: DNA fingerprinting is a technique that shows the genetic makeup of living things.
Q: Using the same template strand, transcribe the DNA: GCA TAG CAA TGC
A: Answer: Transcription : It is the process of transcribing DNA to RNA using the template strand of…
Q: Transcribe the follwing DNA strand into a RNA strand. GTC L8R CAG GTC AUG
A: Transcription is the first step in molecular biology's core dogma: DNA RNA. It is the mechanism of…
Q: DNA template A complementary DNA primer Single-stranded RNA template Four deoxynucleotides (DATP,…
A: Introduction:- The process of determining the sequence of nucleotides (As, Ts, Cs, and Gs) in a…
Q: Which of these is not a tool for comparing DNA sequences? PLINK Fasta BLAST A dotplot e.g. dotlet
A: DNA polymerase is an enzyme. A primer is a single-stranded DNA fragment that binds to template DNA…
Q: What is the sequence of DNADNA strand being synthesized during sequencing? Express answer as a…
A: Gel electrophoresis is used to separate molecules like DNA, RNA or protein, for RNA and DNA agarose…
Q: DirectionS: Bolow is e snapshot of DNA replication. Use the cards below to ccrrectly label the…
A: Replication: is the process in which two identical replicas of DNA are produced from one original…
Q: Describe the basic features of recombinant DNA, the polymerase chain reaction, and DNA fi…
A: Introduction: The direct modification of an organism's genes using biotechnology is known as genetic…
Q: Transcribe the DNA into RNA, then translate the RNA: DNA: 5’ TACGCAAAGCCAATGACT 3’ mRNA:…
A: The process of gene expression involves the transcription of the gene to produce an mRNA and then…
Q: The original DNA template starts with T following the primer sequence if the smallest fragment…
A: Dideoxy nucleotides are similar to regular, or deoxy, nucleotides, but they lack a 3’ OH group.…
Q: Which musical instrument does the replication process resemble? O tuba O trumpet trombone
A: Replication is an important process that takes place in all organisms that ensure the maintenance of…
Q: BamHI Haelll Both 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb Figure 2 How long is the original DNA molecule?
A: If it is a closed circular DNA, BamH1 cut it into three fragments of length 10kb 5kb 2kb
Q: The process by which base pairs combine with each other to form a strand of DNA is called _______.…
A: DNA is composed of four types of nucleotide, adenine, guanine, thymine and cytosine. Adenine pair…
Q: Complete the table below to show the differences between a DNA molecule and an RNA molecule.…
A: Given: Differences between DNA molecule and RNA molecule.
Q: The diagram below shows an autoradiograph ofa DNA sequencing gel. Write the 5' to 3' sequence of the…
A: DNA sequencing is a method used to determine the organism’s actual DNA. The most commonly used DNA…
Q: In which direction is DNA synthesized and in which orientation relative to its template? O 3'->5';…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: 4. Complete the table below: RNA DNA Strand Sugar residue Nitrogenous bases Main Function
A: Nucleic acids are made up of nucleotides, which are the fundamental building blocks of DNA and RNA.…
Q: 5. Below is an image of DNA sequenced using the Sanger sequencing method, where different…
A: Gel electrophoresis is a molecular technique that aims to separate the DNA, RNA, and protein…
Q: S SimUText 2019-2020 X File Edit Go Tools Help Recycle Bin Section 1: DNA Structure NOTES 17/18…
A: The following picture depicts a nitrgenous base, a phosphate group and a deoxyribose sugar.
Q: What type of label is used for fluorescence in situ hybridization (FISH) probes?
A: Answer: Introduction: Fluorescence in situ hybridization (FISH) is a method performed in laboratory…
Q: Compare and contrast the mechanisms by which bacterialcells and eukaryotic cells package their DNA.
A: Nucleic acids, DNA, and RNA are composed of nucleotides. Each nucleotide is composed of a…
Q: Transcribe the following DNA strand into a RNA strand. CAA a BFF GUU CAA GTT
A: DNA strands change into mRNA by transcription.
Q: 4. Draw the number of fragments as well as their sizes as they would migrate on the electrophoresis…
A: Sal1 is a restriction endonuclease i.e it cleaves DNA at the recognition sequence 5'-G/TCGAC-3'…
Q: Replication. Complete the table by writing the sequence of the complementary strand. Strand 1 3’…
A: The DNA is a double helical and phosphate backbone along with nitrogenous bases that are…
Q: Your colleague made the table below comparing DNA Polymerase to RNA Polymerases. Which row is…
A: Transcription is the molecular process which involves the DNA sequences that are transcribed as…
Q: What would happen if we use an endonuclease on DNA obtained from human cells(without PCR) & then…
A: The endonuclease and the exonuclease are the 2 types of restriction enzymes. They cut the DNA…
Q: Compare and contrast the following terms: cDNA and gene Restriction fragment and gene DNA probe and…
A: Gene expression is a process in which the genetic instructions of genes are utilized to manage…
Q: expalin Yeast centromeric DNA sequences
A: Centromere, also known as kinetochores are DNA sequences that are involved in linking a pair of…
Q: Sticky ends are 1. DNA fragment with single - stranded ends 2. produced by the action of DNA…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: Abstract for lab report of isolation, purification and quantification of bacterial DNA.
A: Like other organisms,bacteria use double stranded Dna as their genetic material.however ,bacteria…
Q: Define the following terms:a. DNAb. RNAc. double helixd. genomee. transcription
A: DNA : DNA is deoxyribonucleic acid. It is a long molecule which is made up of nucleotides .…
Q: Replicate the DNA strand AAGGCTAACGGCATTTAACCC. Transcribe the DNA strand AAGGCTAACGGCATTTAACCC.…
A: In most organisms, genetic material is stored in the form of DNA. In humans, each cell's nucleus has…
Q: Replicate, transcribe and translate the DNA strand below. Be sure to label your 5’ and 3’ ends and…
A: DNA has two strand, one strand is actively used as a template in the transcription process, this is…
Q: Define the following terms:a. PCRb. DNA microarrayc. chromosomal jumpingd. genome projecte.…
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…
Q: Which of these is not a tool for comparing DNA sequences? O PLINK O A dotplot e.g. dotlet O Fasta O…
A: There are different tools in bioinformatics that help in sequencing and comparing the DNA sequences.…
Q: Below is a double stranded DNA molecule with a replication bubble. The filled lines represent the…
A: DNA replication refers to an enzyme-mediated complex process that produces replicate or copies of…
Q: One strand of a DNA molecule has the base sequence 5’-CACTTA-3’. The complementary base sequence on…
A: Deoxyribonucleic acid (DNA) is defined as an organic chemical molecule that will contain all the…
Q: What causes microsatellites to be polymorphic?
A: Microsatellites are classified as variable number tandem repeats. These are 2-13 nucleotide long…
Q: 2: Align DNA sequences using dot matrix Horizontal sequence: AGGCTCCC; vertical sequence: GCGCTCCG.…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: cDNA, a term used in recombinant DNA technology meansa) Competitive DNAb) Chemical DNAc) Complex…
A: Deoxyribonucleic acid (DNA) is the genetic material of most organisms. DNA contains the instructions…
Q: Review DNA sequencing and cloning tools. Match term and its description. main technologies for…
A: DNA sequencing is the process of identifying and writing the code of the whole genome in exact…
Q: deduce the DNA sequence based on the following electrophoreograms.
A: The electrophoretic technique is used to separate proteins, DNA, and RNA based on their size and…
Q: DATAAND RESULTS: A. Description and source of isolates Nudeic Acid Source Description BANANA DNA…
A: All living organisms use the same basic molecules.e., DNA (deoxyribonucleic acid) to pass…
Q: Draw the gel electrophoretic pattern that would be seen in dideoxy sequenceanalysis of the DNA…
A: Gel Electrophoresis is a separation technique that was used to separate the Biomolecules such as…
Q: Fill in the following table DNA RNA # of strands Bases sugar Where is it located function
A: Deoxyribose nucleic acid (DNA) and Ribose nucleic acid (RNA) are both genetic materials. They are…
Q: A cloned fragment of DNA was sequenced by using thedideoxy chain-termination method. A part of the…
A: The process is usually defined as the way that they are been determining the sequence of nucleotides…
Q: Suppose that you are given a short fragment of DNA to sequence. You amplify the fragment with PCR…
A: DNA sequencing is a method to determine the sequence of the DNA molecule. Electrophoresis enables…
Q: Make simple steps to extract isolating DNA from strawberries and yeast.
A: Answer
Q: Write in detail about “DNA sequencing by Sanger's method”. DNA Isolation, DNA Fragmentation,…
A: Sanger’s sequencing method is the DNA sequencing method which was developed by Fredrick Sanger and…
Write notes on RAPD, microsatellites DNA, AFLP.
Step by step
Solved in 2 steps
- Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’Discuss/explain where single-stranded DNA are found.In which direction is DNA synthesized and in which orientation relative to its template? O 3'->5'; parallel to template O 3'->5'; antiparallel to template O 5'->3' ; antiparallel to template O 5'->3'; parallel to template
- Describe how Sanger sequencing works. Make sure to mention dNTPs, ddNTPS, template strand, primers:What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC-5 O 3- GCCTACGGGCATATG -5 O 5-GCCTACGGGCATAAG -3 O 5- GCCTACGGGCATATG-3 O3-CGGATGCCCGTATAC -5Draw the gel electrophoretic pattern that would be seen in dideoxy sequenceanalysis of the DNA molecule
- Use the gel image below to determine the sequence of the original DNA template strand sequenced using Sanger sequencing from the 5' end to the 3' end. C G T TAC GGT CAT TAC TGG CAT ATG CCA GTA ATG ACC GTA TAC GGT TACUse the following table to describe the difference and similarities between DNA and RNA. • Place a check mark / in the column if the characteristic applies. Place an X in the column if the characteristic does not apply. Characteristic DNA RNA type of nucleic acid composed of nucleotides Contains deoxyribose sugar Contains ribose sugar Contains glucose Contains phosphate groups Single stranded Double stranded Contains guanine, cytosine and adenine Contains thymine Contains uracil Always found in the nucleus Found in the nucleus and in the cytoplasmYou have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTATGTGTAACTTGTCAT 5’
- Compare and contrast the properties of DNA polymerase and RNA polymerase. Drag the appropriate items to their respective bins. can proofread using a 3'-to-5' exonuclease activity polymerize in a 5'-to-3' direction Only RNA can initiate strand synthesis catalyze phosphodiester bond formation to polymerize nucleotides into nucleic acids Only DNA use deoxyribonucleotide triphosphates as substrates can only extend an existing strand Both Reset Help dependent on a DNA sequence template use ribonucleotide triphosphates as substratesLabel the following parts of the DNA molecule Phosphate, sugar, nitrogenous base Nucleotide base pair , hydrogen bond 2.Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original: AGAGAGAGAGAGAGAGAG Ser UUA UCA UAA Stop UGA Stop Leu UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU His Mutated: AGAAGAGAGATCGAGAGA CUC CC CAC CGC Leu Pro Arg CỦA CCA CAA CGA Gin CUG CCG CAG CGG AUU ACU AAU AGU Ser Asn What amino acid sequence will be translated based on the AUC Ile ACC AAC AGC The mutated DNA? Hint* must transcribe and translate the AUA ACA AGA AAA arg Lys Met or Start AUG ACG AAG AGG mutated strand to find the answer. GUU GCU GAU GGU Asp GUC GCC GAC GGC Val Ala Gly G GUA GCA GAA GGA Glu GUG GCG GAG GG First Base Third Base