Why was ribosomal RNA (rRNA) used to create the first phylogenetic tree? Group of answer choices rRNA is very stable and can survive for billions of years rRNA is found in high abundance in bacteria and eukaryotes but is absent from archaea rRNA sequences are the same in all organisms rRNA is found in all living things allowing it to be a barometer of evolution rRNA mutates rapidly making it a good tool for tracking the mutations

Q: Why did the cost of sequencing genomes drop precipitously in the mid-late 2000s?   1. Fredrick…

A: The correct answer is 3 - "Deep" sequencing was invented.

Q: Which of the following is not a reason why RNA is expected as one of the first primary molecules in…

A:

Q: How many 3 base sequences are in the Genetic Code? 12 20 22 64

A: The DNA code is read by the cell in three-base groups. Each codon, or triplet of bases, determines…

Q: 5. Which of these CANNOT result in evolution? O Mutations O Natural selection OSmall population size…

A: Evolution is a steady phenomenon that brings about change and alter life from simplex to more…

Q: EcoRI is an enzyme that comes from the bacteria E. coli and recognizes the DNA sequence GAATTC.…

A: EcoRI is an enzyme isolated from the E. coli bacteria, they used it as a cutting molecule that…

Q: Luria and Delbruck's experiemnt demonstatred that  mutation of genetic materials is a random event…

A: Bacteria is a prokaryote and posses circular genome along with plasmids (not genomic…

Q: Why is it necessary to use a CDNA molecule instead of an original genomic DNA molecule to clone a…

A: Deoxyribonucleic acid, abbreviated as DNA, is a double-helix made-up of nucleic acids. Its role in…

Q: Data Table DNA ase sequence AAT GGG ATA AAA GTT A Process B mRNA codon с E D tRNA Process |anticodon…

A: A Genetic table is the entire set of interactions between codons and amino acids is said to make up…

Q: Researchers have reported advances in their attempts to synthesize life from scratch in a…

A: There are multiple questions that can be answered by this experiment. But the principal question…

Q: The "molecular clock" of the rate of change in a segment of DNA during evolution depends on which of…

A: The objective of the question is to identify the factors that influence the rate of change in a…

Q: Which of the following statements is true about consensus sequences in DNA? Group of answer choices…

A: Short nucleotide segments which recur often in conserved sequences are known as consensus sequences.…

Q: Which of the following is true? Group of answer choices All prokaryotes have a common genetic code,…

A: The amino acid sequence of proteins is determined by the sequence of nucleotides in deoxyribonucleic…

Q: Researchers a SKull a small piece of tissue still attached, were only able to extract a small amount…

A: DNA extraction is a popular technique for isolating DNA from a cell's nucleus. DNA crystallises.

Q: Match the experiment to the key learning Rice has 51 000 protein- coding genes, but humans have…

A: The C-value paradox, also known as the C-value enigma, is the observation that the total amount of…

Q: I. During the past few decades, researchers have been using the 16S rRNA gene, which is a specific…

A: 16S rRNA gene is generally carried by all microscopic organisms and encodes a little subunit of the…

Q: Identify the concept and importance of mutations. Select all that apply about mutations: Mutations…

A: Introduction Mutation can lead to various disorders such as cancer and a wide range of genetic…

Q: The first human genome was sequenced and pieced together by aligning the sequenced DNA fragments:…

A: The first human genome was sequenced through a process called shotgun sequencing.In shotgun…

Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…

A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…

Q: Recombinant DNA technology describes a set of molecular techniques that allow us to do what with…

A: Recombinant DNA technology involves techniques like restriction digestion, polymerase chain reaction…

Q: Molecular Cloning What does molecular cloning mean (with figures/narratives) How does molecular…

A: A) Molecular cloning is a bunch of trial techniques in molecular biology that are utilized to gather…

Q: Based on the information above, what can you speculate about the possible evolution of the genes…

A: Rab proteins are small GTP-binding proteins within a superfamily of GTPases known as the Ras…

Q: Higher rates of mutation are found in RNA viruses. Why? Replication of their genomes does not…

A: RNA  nucleotides are more unstable than DNA nucleotides

Q: The diagram below shows a hybridization experiment between a eukaryotic MRNA and the template strand…

A: It was performed using both the cytoplasmic RNA (ribonucleic acid) and nuclear pre-mRNA (messenger…

Q: The following is part of a DNA sequence. What is its complementary sequence? TGTTCGAGCCA □a.…

A: Complementary base pairing is a phenomenon where in the double-stranded DNA, guanine is always…

Q: has a genetic code similar to organisms of Earth, except that there are three different nitrogenous…

A:

Q: Report the differences you've observed between the nucleotide sequences of the different species in…

A: The process by which species adapt to their environment over time is called evolution. The…

Q: what does this tell us about the first intron of tra-RBcompared to that of tra-RA

A: Drosophila melanogaster possesses a tra gene which is a protein transformer gene needed for…

Q: This is a review question please help me understand by explaining.

A: According to the phylogenetic analysis of the 16S rRNA gene, microorganisms A, C, and D are more…

Q: Which of the following graphically shows the evolution of protein sequences? O Blosum-62 BLAST O…

A: Protein Sequencing:  Protein sequencing is the technique of determining the amino acid sequence of a…

Q: a rice species low high diverged six five whole genomes gene families homologous genes Duplication a…

A: Gene:  The term "gene" has a variety of meanings in biology. The molecular gene is a sequence of…

Q: In the space below, write the Central Dogma of molecular biology.

A: In molecular biology, Central Dogma is the procedure through which genetic information gets…

Q: 101. As discussed in lecture, recent studies of Neanderthals' nuclear DNA indicates that…

A: A biomolecule or biopolymer called deoxyribonucleic acid (DNA) is a nucleic acid that is found in…

Q: which of the following is NOT a possible source of the monomer building blocks in the RNA world…

A: RNA world hypothesis assumes the formation of early living beings which uses RNA as genetic…

Q: what is RNA World hypothesis? What is RNA? What are the building blocks of RNA

A: The biopolymers, macromolecules, essential to all known forms of life, made up of pentose sugar,…

Q: If a change in a DNA sequence occurred, could that affect the mRNA? Why or why not? Group of answer…

A: Answer: DNA is serve as the genetic material in most of the individuals , for division, it is first…

Q: wo genes that evolved from the same common ancestral gene, but are now found as homologs in…

A: Gene is the functional and basic unit of heredity, made up of DNA. Every organism is composed of…

Q: A gene from one organism can be inserted into another kind of organism, and it will produce the same…

A: A genetic code is a set of three codons. Codons are nucleotides that correspond to a specific amino…

Q: ween a DNA l

A: DNA Library : It is the collection of DNA sequences from different organisms. cDNA : It is the DNA…

Q: SEQUENCE 28 SEQUENCE 21 SEQUENCE 22 SEQUENCE 23 SEQUENCE 24 SEQUENCE 25 SEQUENCE 26 SEQUENCE 27

A: A phylogenic tree represents the evolutionary relationship between species or even proteins. The…

Q: How did the different members of families of genes, such as hemoglobin,                   arise…

A: During the evolution of vertebrates duplicated haemoglobin genes diverged with respect to functional…

Q: Gene 3: Gene 3: Gene 4: Gene 4: Gene 5: Gene 5: Gene 6: Gene 6: Gene 7: Gene 7: Gene 8: Gene 8: Gene…

A: The DNA sequence will be transcribed into mRNA that contain the genetic codon by the process of…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.