Q: A synthetic mRNA was made by linking together 5 G-A 3' dinucleotides. Which amino acid(s) would be…
A: The key enzyme involved in transcription is RNA polymerase, which synthesises a complementary strand…
Q: Example: Beyonce has brown eyes. Her eyes look brown because her DNA codes for a brown pigment in…
A: The central dogma of molecular biology illustrates the flow of genetic information in a cell. The…
Q: 4. What would be the code that the methionine tRNA anticodon would carry? 5. Suppose…
A: codon are three nucleotide sequence either DNA or RNA that codes for a specific amino acid during…
Q: What type of molecule contains the site where amino acids link together to make a polypeptide? a.…
A: Translation is a process of protein synthesis from an mRNA sequence. It occurs in the ribosomal…
Q: During the transcription of DNA to mRNA, __________. Group of answer choices a) RNA polymerase moves…
A: RNA polymerase moves in the 3' to 5' direction and the RNA strand transcribed comes out in 5' to 3'…
Q: You are studying a human cancer cell line and you notice that you see the normal amount of RNA but…
A: INTRODUCTION Mutation Mutations are the sudden heritable changes in the genetic material occur due…
Q: GIVEN THE FOLLOWING CODING SEQUENCE FOR DNA, PROVIDE THE SEQUENCE OF THE COMPLEMENTARY(TEMPLATE)…
A: DNA, RNA, AND PROTEIN SYNTHESIS blank is filled below.
Q: 1. What would be the amino acid sequence encoded by the mRNA 5' C C A U G A C G U C G G A U C A A U…
A: Only proline amino acid form as second codon is stop codon here
Q: a prokaryote cell a molecule of mRNA that has a nucleotide sequence of CUAAUGGUUCC would use this…
A: Answer :: Option a) is correct that is 3, because Proteins are made up from a set of 20 amino…
Q: A CODING STRAND of DNA has the sequence 5' ATGCCG 3' what would the resultant mRNA transcript…
A: Coding strand is the strand which contain the sequence that are identical to the mRNA transcript…
Q: Which of the following best describes the central dogma of molecular biology? A) mRNA is…
A: In molecular biology, a central dogma is an illustration showing the flow of genetic information…
Q: 5. You find a mutant with a 10-bp insertion between the (+1) and the upstream promotor sequences.…
A: The transcription is the process of the mRNA formation from gene or DNA sequence. The mRNA so formed…
Q: RNAi is produced when Question 26 options: a single-stranded DNA shares the…
A: RNA interference (also called “RNA-mediated interference”) is a mechanism for RNA-guided regulation…
Q: 3' -T ACATC T T G G C GAC GAC T-5' Mutated DNA Sequence #1: MRNA sequence? (Circle the change) Amino…
A: 1)DNA - 3'- TAC ACC TTG GCG ACG ACT-5' mRNA - 3'- AUG UAG AAC CGC TGC UGA-5' Amino acid sequence –…
Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…
A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…
Q: A eukaryotic mRNA has 1066 total nucleotides. 50 of these are the 5'UTR and 50 of these are the…
A: In a mature transcript, there are 5' untranslated (UTR) regions and 3' UTR which do not code for any…
Q: Now imagine that a mutation occurred at the first G in the DNA sequence above and the G became a C.…
A: Hello, thank you for your question, since you have not mentioned the DNA orientation I am answering…
Q: A scientist is trying to get a bacterium to make human insulin. The scientist uses restriction…
A: Recombinant DNA technology is a boon invented by genetic engineers in order to produce important…
Q: The information a cell needs to function is found on the DNA molecule in the form of a. multiple…
A: DNA, or deoxyribonucleic acid, is the inherited material in people and in all living forms.…
Q: The diagram below shows the result of a hybridization experiment between a eukaryotic mRNA and the…
A: The process of hybridization refers to the combination of two complementary single-stranded RNA or…
Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…
A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…
Q: Which of the following represents the correct sequence of steps that occur in protein synthesis?…
A: Protein synthesis represents the major route of disposal of amino acids.Amino acids are activated by…
Q: . (a) Which codon is the start codon in the mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 AAU…
A: Ans - a.) AUG is the start codon in the mRNA 5 - AAUAUGCGGAUGCCCGAA -3. # AUG acts as initiator…
Q: Which of the following best describes the central dogma of molecular biology? O A) MRNA is…
A: Introduction In molecular biology, a central dogma is an illustration showing the flow of genetic…
Q: A frameshift mutation occurs in a DNA strand. The mutation is a deletion of the two nucleotides…
A: A frameshift mutation is a genetic mutation caused by a deletion or insertion in a DNA sequence that…
Q: Two cells use the same segment of DNA to produce two different proteins. The mRNA transcribed by…
A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…
Q: The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’…
A: Answer: Central Dogma : It is the complete procedure of replication , transcription and translation…
Q: Part II. Give what is needed. |Original DNA Sequence: TACACCT T G G C G A C G A C T MRNA Sequence: |…
A: Q. Frameshift mutation: A frameshift mutation is a genetic mutation that occurs when a deletion or…
Q: hypothetical protein is 250 amino acids long how many nucleotides are in the code and sequence of…
A: A hypothetical protein is 250 amino acids. Each amino acid residue in a polypeptide chain was coded…
Q: A scientist studies the production of a key digestive enzyme in silk moths. The moths have one gene…
A:
Q: If a protein is made up of 1000 amino acids 1) How many nucleotides will its mRNA contain…
A: Amino acids are the building blocks of proteins, which are responsible for the expression of genes.…
Q: 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA.…
A: The double-helical structure of DNA was transcribed into mRNA molecules and these mRNA molecules are…
Q: What would be the sequence of the bases in the messenger RNA in a 5' to 3' direction? 3.) By using…
A: The synthesis of RNA from DNA is called transcription and the synthesis of the proteins with the…
Q: A biologist inserted a gene from a human liver cell into the DNA of a bacterium. The bacterium then…
A: It is majorly present within the nucleus. DNA can exist in different levels of complexity. Primary…
Q: An R loop experiment was performed on two different mRNA's. The first showed one R loop, while the…
A: Eukaryotic mRNA is transcribed post-transcriptionally to form mature mRNA. The post-transcriptional…
Q: Imagine you took a protein coding sequence of DNA (a gene) from a pig, and added that sequence of…
A: The DNA is the genetic element in living organisms that contain specific sequence. The functional…
Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…
A: The gene is expressed from DNA into protein by Central Dogma. The transcription and translation…
Q: Answer this following: 1. mRNA of Gene F 2.mRNA of gene G 3.polypeptide of gene F 4.polypeptide…
A: Synthesis of a protein is a very complicated process. the instructions of individual amino acids…
Q: 1. Using the DNA provided transcribe DNA into mRNA. 2. Use the mRNA strand you created and break it…
A: DNA is the main genetic material present in most organisms and stores all the genetic information of…
Q: does DNA encode the instructions to make us? Select all the true statements. Group of answer choices…
A: DNA is necessary for all living things, including plants. It plays a role in heredity, protein…
Q: Now imagine that a mutation occurred in the second T of the codon below and the T became a G. How…
A: A mutation occurs when there is a change in the nucleic acid sequence. These mutations could be…
Q: A eukaryotic mRNA has 703 total nucleotides. 50 of these are the 5'UTR and 50 of these are the…
A: The triplet codon (genetic code) is the group of three consecutive nucleotides that code for a…
Q: What is a promoter? Group of answer choices A region on mRNA that will indicate the ending point…
A: Promoter These are the DNA sequences which defines where the transcription of gene by RNA polymerase…
Q: In a fly egg, the nurse cells are killed before they can produce bicoid mRNA. What will happen?…
A: The development of Drosophila is an important event as Drosophila is utilized as a model organism…
Q: 3. Below is the sequence of DNA template for transcribing a segment of mRNA. 5 ATGTGGTTATAGCTAACC 3…
A: In the question, we must write the complementary base of the sequence. Our mRNA sequence will be in…
Q: A DNA template strand having the sequence shown below would produce an mRNA molecule with that with…
A: DNA gets transcribed into mRNA by using RNA polymerase enzyme. mRNA is single stranded and DNA is…
Q: mRNA +sense, –sense, or a mixture of the 2? What about DNA? Which best describes the template strand…
A: RNA does not forms a helix where as DNA forms a double helix. During transcription RNA polymerase…
Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…
A: The central dogma The central dogma is the process involving three major events in cells these are…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 2 steps
- 1. Using the DNA provided transcribe DNA into MRNA. 2. Use the mRNA strand you created and break it up into codons. 3. Plug the codons into the amino acid chart to determine the correct amino acid needed to build that protein. 4. Identify the protein you made by comparing the sequence to the pictures 5. Answer the questions for each protein molecule you build before moving on to the next. Protein 1: DNA AAGACCGTATAC MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis?Scientists can put spider genes into yeast. The yeast can decode the spider genes to make spider silk protein. Why is this so? Evaluate the models. MODEL 1 Spider DNA mRNA mRNA Spider Protein 3. The yeast used machinery from a spider to read the spider genetic code, so both organisms make a protein that is identical. 1. The yeast transcription machine cannot read the spider gene, so yeast uses a machine from a spider to make an mRNA copy. Transcription Machine 2. The yeast translation machine cannot read the mRNA, so yeast uses a machine from a spider to make the protein. ◄ Translation Machine MODEL 2 Spider DNA ▼ mRNA mRNA Spider Protein 3. Yeast and spiders use the same genetic code, so both organisms make a protein that is identical. 2. Explain why one model is correct and the other one isn't. 1. Which model correctly explains what happens inside the yeast cell? 1. The yeast transcription machine reads the spider gene and makes an mRNA copy. Transcription Machine 2. The yeast…Directions: 1. Use the DNA code to make a replicated copy of DNA. 2. Use the replicated DNA code to create your transcription mRNA code. 3. Use the mRNA code to create your tRNA anticodon. 4. USE THE MRNA CODE TO DETERMINE YOUR AMINO ACIDS. MAKE SURE TO PUT YOUR LETTERS IN ALL CAPS! DNA ATG GCA AGC GCT TGA DNA TAC REPLICATION DNA TO MRNA AUG TRANSCRIPTION MRNA to tRNA UAC ANTICODON MRNA to AMINO AUG (START) (STOP) ACID TRANSLATION DNA ATG ССА GAC ACG TGA DNA ТАС REPLICATION DNA TO MRNA AUG TRANSCRIPTION MRNA to TRNA UAC ANTICODON MRNA to AMINO AUG (START) (STOP) ACID TRANSLATION
- Part II. Give what is needed. |Original DNA Sequence: TACACCT T G G C G A C G A C T MRNA Sequence: | Amino Acid Sequence: Mutated DNA Sequence #1: T A C A T C T T G G C GAC GA C T What's the mRNA sequence? (Circle the change) What will be the amino acid sequence? . Will there likely be effects?. What kind of mutation is this? Mutated DNA Sequence #2: T A C G AC C T T G G C G A C G AC T What's the mRNA sequence? (Circle the change) What will be the amino acid sequence?. Will there likely be effects?. What kind of mutation is this? Mutated DNA Sequence #3: T A C A C C T T A G C GAC GA C T What's the mRNA sequence? (Circle the change). What will be the amino acid sequence?. Will there likely be effects? | What kind of mutation is this? Mutated DNA Sequence #4: T A C A C C T T G G C GACTAC T What's the mRNA sequence? (Circle the change), What will be the amino acid sequence?. Will there likely be effects? - What kind of mutation is this? Mutated DNA Sequence #5: T A C A C C T T G G G A C…The last two questions 4 and 5 The last two questions 4 and 5 The last two questions 4 and 5 Use the mRNA coding chart above to answer these questions. he following is the base sequence on a portion of a template strand of DNA. 3 ‘ TACGCCAGTGGTTCGCAC 5’ Give the base sequence of the complementary DNA strand. Give the base sequence of the strand of mRNA read from the original DNA template strand. List, in order, the amino acids that would be present in this protein? 4. What would be the code that the methionine tRNA anticodon would carry? 5. Suppose a mutation altered the original DNA strand so that the 6th nucleotide was changed to a T i) How would this change the protein? ii) What type of mutation is this?Now imagine that a mutation occurred at the first G in the DNA sequence above and the G became a C. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T T C This would be an example of which type of a point mutation?__________________________
- Which choice best fits the blank? Refer to picture. The ribosome moves along the mRNA strand. In panels b, c, and d, new tRNAs carrying ___________. match up with the codons of the mRNA strand. After each tRNA locks into place, a peptide bond forms between the amino acid the tRNA is carrying and the amino acid already there. This process repeats until the end of the sequence is reached. A. ProteinsB. NucleotidesC. Amino AcidsThe following sequence is the coding strand of a piece of DNA. Type out the corresponding template strand of DNA and the MRNA that could be made from this piece of DNA if you assume that transcription begins at the first nucleotide listed. Next, use the attached genetic code table to translate the mRNA into a polypeptide that could be made from the message and list that sequence along with those of the DNA and MRNA. Coding strand 5'-TACCGTATGATTCTCTTGTATGGGTAACC-3' Second letter U UUU UUC UCU UAU UGU Phe Tyr Cys UCC UCA UAC UAA STOP UAG STOP UGG| Trp UGC Ser UUA UGA STOP A UUG Leu UCG CUU CCU CC CAU CGU CGC His CUC C CUA CAC САА Leu Pro Arg CCA CGA Gln CUG СCG CAG CGG AGU Ser AAU AAC ACU AUU lle AUC Asn ACC ACA AGC Thr AAA AGA AUA AUG Met Arg ACG AAG Lys AGG GAU GCU GCC GUU GGU Asp GAC GGC GGA GUC Val Ala Gly GCA GCG GAA GAG GUA Glu GUG GGG Third letter UCAG UCAG 5CAG UCAG First letterBelow is the coding strand of DNA. Transcribe it to the proper mRNA: 5' ATTCGCTAGATCA3 How do I do a diagram on this
- The following is a prokaryotic DNA sequence. Fill in the other strand of DNA. Be sure to label the ends appropriately (5’ and 3’). Transcription goes from left to right and stops after the right most base pair. On your DNA, indicate which is the coding/partner and which one is the template. Write out the pre-mRNA transcript. Be sure to label the ends appropriately (5’ and 3’). DNA 5’ – T G G G G G A T A C C G C A T G C A G G T A G T C T A A G C G A G T G A C – 3’ DNA mRNA1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'- TACCATGAGAATTGTGG TCACCTTTTT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid SequenceNow imagine that a mutation occurred in the g of the codon below and the G became a C. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid A T G A T C This would be an example of which type of a point mutation?__________________________
