A portion of a single strand of DNA is shown below, which contains a amino acid-coding sequence. 5'ACTGCTATGATTGGCTTAGCTGCGTGGACCGTGTCATAGACTGGCT 3' 1. First use this strand as a blueprint to write the Base sequence of a DNA strand that is complementary to this one. 2. Transcribe the complimentary DNA strand that that you made in question 1 into mRNA, and write the mRNA sequence. 3. Finally, use the genetic code dictionary to translate the mRNA that you made in question 2 into the appropriate amino acid sequence.
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
A portion of a single strand of DNA is shown below, which contains a amino acid-coding sequence. 5'ACTGCTATGATTGGCTTAGCTGCGTGGACCGTGTCATAGACTGGCT 3' 1. First use this strand as a blueprint to write the Base sequence of a DNA strand that is complementary to this one. 2. Transcribe the complimentary DNA strand that that you made in question 1 into mRNA, and write the mRNA sequence. 3. Finally, use the genetic code dictionary to translate the mRNA that you made in question 2 into the appropriate amino acid sequence.
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
