Why Sanger sequencing uses ddNTPs and how they differ functionally from dNTPs. Does Sanger sequencing minimize the length of replication since phosphodiester bonds are not forned during DNA replication. Also, does it differ from dNTPs functionally since it lacks two hydroxyl groups?

Why Sanger sequencing uses ddNTPs and how they differ functionally from dNTPs. Does Sanger sequencing minimize the length of replication since phosphodiester bonds are not forned during DNA replication. Also, does it differ from dNTPs functionally since it lacks two hydroxyl groups?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 1P: Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724...

See similar textbooks

Related questions

Q: A researcher used the Sanger method to sequence the DNA fragment shown. The red asterisk indicates a…

A: Sanger sequencing, also known as the chain termination method, is a technique used to determine the…

Q: All known DNA polymerases catalyze synthesis only in the 5' → 3' direction. Nevertheless, during…

A: DNA replication is the process of making two identical copies of DNA. The process is carried by the…

Q: Which of the following statements about DNA polymerase III holoenzyme from E. coli are correct. 1.…

A: DNA polymerase II is the primary enzyme involved in DNA replication. It is a multiprotein complex…

Q: A G-C baseрair the cytosine to uracil (deamination). occurs, after two rounds of replication this…

A: Deamination is the process in which the cytosine is converted to uracil in the DNA. This results…

Q: Replication of a circular DNA molecule can occur by either theta () replication or by rolling…

A: Introduction :- Plasmids are tiny circular DNA molecules with a few to over one hundred genes. The…

Q: A solution containing single stranded DNA with the sequence 5’ATGGTGCACCTGACTCCTGAGGAGAAGTCTNNNNN’3…

A: In biology, DNA replication is that the process of forming 2 identical replicas of deoxyribonucleic…

Q: Why is it unfavorable for RNA molecules to adopt a double-helix structure similar to B-DNA?

A: Introduction : Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are probably the most…

Q: Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank)

A: This question is based on the Dna replication.

Q: Why does DNA replication only occur in the 5’ to 3’ direction? (A) 5' 3' (B) 5' 3' Should be PPP…

A: The central dogma of the cell is the process of the transfer of genetic material from DNA to…

Q: The replication of DNA begins at a special site with the formation of leading to the molecule…

A: In Messelson and Stahl experiment, they proposed the semi-conservative nature of DNA. In this…

Q: Using pencil, you will draw a representation of DNA replication along the leading and lagging…

A: DNA replication is the process that occurs in all living organisms replicate their DNA during…

Q: In both leading and lagging strand synthesis, DNA replication always proceeds in a certain…

A: "Since you have asked multiple questions, according to Bartleby's guidelines we are eligible to…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

Why Sanger sequencing uses ddNTPs and how they differ functionally from dNTPs.

Does Sanger sequencing minimize the length of replication since phosphodiester bonds are not forned during DNA replication.

Also, does it differ from dNTPs functionally since it lacks two hydroxyl groups?

Definition Definition Mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of itself. DNA molecules utilize a semiconservative method for replication. DNA replication is the most essential part of biological inheritance and is crucial for cell division during growth and repair of damaged tissues.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Examine the following DNA sequence (only one strand is shown). The shown strand will be referred to as Strand 1. The complementary strand will be referred to as Strand 2: 5’ TTTAAGCCGTACCGATATAATGTAAGGCGAGCTTGACCGTCTTGGGCATCATA 3’ There is an eleven (11) base pair sequence that serves as a replication origin. Write below the most likely 11 nucleotides on this strand that serve as the replication origin. Think carefully about base pairing.
why DNA polymerase cannot remove all the RNA primers from Okazaki fragments to form a lagging strand. Explain.
If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAG Use the editor to format your answer
A solution containing single stranded DNA with the sequence 5’ATGGTGCACCTGACTCCTGAGGAGAAGTCTNNNNN’3 undergoes DNA replication in vitro in the presence of all four nucleotides plus an amount of dideoxyadenosine triphosphate sufficient to compete for incorporation with deoxyadenosine triphosphate. How many and what DNA fragments are expected?
The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of replication.Please supply the specific pieces of information requested by the boxes below.
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
Would my anwser be correct for this question?
The anti-viral drug Acyclovir is a nucleotide analog that is lacking the 3’ OH group which is required to form a 3’→5’ phosphodiester bond. This drug is ineffective against DNA polymerases with proofreading abilities, which is why human DNA polymerases are not targeted. Acyclovir can be used to treatsevere cases of Epstein-Barr viral (EBV) infection, but has little to no effect under non-severe infections. Based on this information, EBV will use ________ DNA polymerase during severe infections and __________ DNA polymerase during non-severe infections. Human; Human EBV; Human EBV; EBV Human; EBV
Even though the eukaryotic genome is thousands of times larger than the prokaryotic genome, DNA replication times are relatively similar. Explain how this is possible.
Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.
In both leading and lagging strand synthesis, DNA replication always proceeds in a certain direction. What direction is this? Explain how oligonucleotide primers in the Polymerase Chain Reaction work (PCR)
If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the complimentary strand without and spaces, commas, symbols or anything else besides the nucleotide sequence (e.g. only: AAGCATCCGCTTA). Give me the complimentary sequence in the 3' to 5' orientation.