Why Sanger sequencing uses ddNTPs and how they differ functionally from dNTPs. Does Sanger sequencing minimize the length of replication since phosphodiester bonds are not forned during DNA replication. Also, does it differ from dNTPs functionally since it lacks two hydroxyl groups?

Why Sanger sequencing uses ddNTPs and how they differ functionally from dNTPs. Does Sanger sequencing minimize the length of replication since phosphodiester bonds are not forned during DNA replication. Also, does it differ from dNTPs functionally since it lacks two hydroxyl groups?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 1P: Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724...

See similar textbooks

Related questions

Q: A researcher used the Sanger method to sequence the DNA fragment shown. The red asterisk indicates a…

A: Sanger sequencing, also known as the chain termination method, is a technique used to determine the…

Q: Escherichia coli (E. coli) has one replication origin that contains specific genomic sequences…

A: DNA replication It is defined as the process through which the copying of DNA takes place in cells.…

Q: All known DNA polymerases catalyze synthesis only in the 5' → 3' direction. Nevertheless, during…

A: DNA replication is the process of making two identical copies of DNA. The process is carried by the…

Q: Which of the following statements about DNA polymerase III holoenzyme from E. coli are correct. 1.…

A: DNA polymerase II is the primary enzyme involved in DNA replication. It is a multiprotein complex…

Q: A G-C baseрair the cytosine to uracil (deamination). occurs, after two rounds of replication this…

A: Deamination is the process in which the cytosine is converted to uracil in the DNA. This results…

Q: Replication of a circular DNA molecule can occur by either theta () replication or by rolling…

A: Introduction :- Plasmids are tiny circular DNA molecules with a few to over one hundred genes. The…

Q: 3)(recall) Replication: what would be the CORRECT ORDER OF NUCLEOTIDES (? ?????) in the newly…

A: DNA is the deoxyribonucleic acid. It is a genetic material present in the nucleus.

Q: A solution containing single stranded DNA with the sequence 5’ATGGTGCACCTGACTCCTGAGGAGAAGTCTNNNNN’3…

A: In biology, DNA replication is that the process of forming 2 identical replicas of deoxyribonucleic…

Q: The base analog 5-bromouracil (5BU), which sterically resembles thymine, more readily undergoes…

A: Base analogs are the purines and pyrimidines that are similar in structure to the normal DNA bases.…

Q: Why is it unfavorable for RNA molecules to adopt a double-helix structure similar to B-DNA?

A: Introduction : Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are probably the most…

Q: Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank)

A: This question is based on the Dna replication.

Q: What is generated from the replication of DNA ? what method is used ? Describe the process. What are…

A: The process of DNA replication is one of the first processes that is described in the central dogma.…

Q: Why does DNA replication only occur in the 5’ to 3’ direction? (A) 5' 3' (B) 5' 3' Should be PPP…

A: The central dogma of the cell is the process of the transfer of genetic material from DNA to…

Q: The replication of DNA begins at a special site with the formation of leading to the molecule…

A: In Messelson and Stahl experiment, they proposed the semi-conservative nature of DNA. In this…

Q: Using pencil, you will draw a representation of DNA replication along the leading and lagging…

A: DNA replication is the process that occurs in all living organisms replicate their DNA during…

Q: In both leading and lagging strand synthesis, DNA replication always proceeds in a certain…

A: "Since you have asked multiple questions, according to Bartleby's guidelines we are eligible to…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

Why Sanger sequencing uses ddNTPs and how they differ functionally from dNTPs.

Does Sanger sequencing minimize the length of replication since phosphodiester bonds are not forned during DNA replication.

Also, does it differ from dNTPs functionally since it lacks two hydroxyl groups?

Definition Definition Mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of itself. DNA molecules utilize a semiconservative method for replication. DNA replication is the most essential part of biological inheritance and is crucial for cell division during growth and repair of damaged tissues.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Why is DNA not soluble in ethanol whereas other components cells are soluble. What is the rationale behind DNA precipitation in solution
Examine the following DNA sequence (only one strand is shown). The shown strand will be referred to as Strand 1. The complementary strand will be referred to as Strand 2: 5’ TTTAAGCCGTACCGATATAATGTAAGGCGAGCTTGACCGTCTTGGGCATCATA 3’ There is an eleven (11) base pair sequence that serves as a replication origin. Write below the most likely 11 nucleotides on this strand that serve as the replication origin. Think carefully about base pairing.
why DNA polymerase cannot remove all the RNA primers from Okazaki fragments to form a lagging strand. Explain.
If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAG Use the editor to format your answer
Would my anwser be correct for this question?
Even though the eukaryotic genome is thousands of times larger than the prokaryotic genome, DNA replication times are relatively similar. Explain how this is possible.
BamHI site BamHI site kanT 3755,6p 784 bp PAMP 4539 bp 2332 pp PKAN 4207 bp HindllI site 1875 bp amp HindlII site Origins of replication You are using these two plasmids to make a recombinant DNA molecule. You want to make a molecule, that has two origins of replication and is amp but NOT kanR, using only one fragment from each plasmid. How large, in base pairs, will be your desired recombinant DNA molecule? O 6087 base pairs O 5630 base pairs O 2659 base pairs O 8746 base pairs 47 8 24 & 4. 8. 9. 4 5 6 RI T 13 H. 2 K FL
Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.
Can you please answer these questions. I don’t know the right answers?
Assume that the sequence of bases shown below is presenton onenucleotide chain of a DNA duplex and that the chain has openedup at a replication fork. Synthesis of an RNA primer occurs on thistemplate starting at the base that is underlined.(a) If the RNA primer consists of eight nucleotides, what is itsbase sequence?(b) In the intact RNA primer, which nucleotide has a free 3'-OHterminus?3'.......GGCTACCTGGATTCA....5'
If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the complimentary strand without and spaces, commas, symbols or anything else besides the nucleotide sequence (e.g. only: AAGCATCCGCTTA). Give me the complimentary sequence in the 3' to 5' orientation.
Does Z-DNA have major and minor grooves? Explain.