Why do most replication errors occur? O 1. DNA polymerases work very fast and mistakes are inevitable. O 2. DNA repair mechanisms do not work well O 3. DNA replication is a slow and uncommon process. O 4. The hydrogen bonds between base pairs are weak. O 5. DNA ligase often binds incorrect sections of DNA.
Q: What do you mean by DNA polymerase δ?
A: Introduction: DNA polymerase δ is one of the multiple types of DNA polymerases found in eukaryotes.
Q: How is each new nucleotide added to the growing end of a DNA strand? a. A dehydration…
A: DNA is a polymer of deoxyribonucleoside monophosphates (dNMP) covalentlylinked by…
Q: how to integrate single helix and double helix dna
A:
Q: 2. How are enzymes involved in this process? 3. What happens when DNA "unzips"? 4. Why is it…
A: This page contain link but that link is not opening so we are answering first 3 questions. For rest…
Q: AKS 5b: Using the semi-conservative model of DNA replication, how many of the resulting DNA…
A: Semi conservative replication The replication of DNA is semi conservative in nature because the…
Q: Which of the following about the DNA synthesis reaction is false? O Phosphodiester bond formation…
A: DNA replication is the process by which DNA duplicates itself using DNA as a template and DNA…
Q: What is carbohydrate ring number and how does it help with understanding DNA replication
A: Carbohydrate ring number is the number that is assigned to the carbon ring for the presence of a…
Q: Which letter(s) represent the 3' end of the DNA molecule? You can choose more than one answer. B…
A: which letter represent the 3' end of the DNA molecule you can choose:
Q: When does spontaneous mutation occur? A. a DNA base is an unstable tautomeric form as the…
A: Induced mutation occur after treatment of organism with mutagen. Spontaneous mutation occur as a…
Q: What to restriction enzymes do? O They cut at specific locations on both strands in the…
A:
Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction…
A: ••Complimentary strand of DNA is made by by process of Replication Replication is process in which…
Q: Fill in the blanks in the paragraph about DNA replication. There are many _____________ involved in…
A: DNA replication is a mechanism whereby DNA copies itself during cell splitting.
Q: What is the effect of ionizing radiation on DNA? a. faster replication b. the formation of…
A: The effect of ionizing radiation on DNA is that their is breaks in DNA molecule. Ionizing radiation…
Q: What are major functions that DNA polymerase performs? A. unzips the DNA strand and makes the new…
A: The process of replication of DNA is catalysed by various sets of enzyme namely: DNA polymerase, DNA…
Q: How can replication occur at several places along a DNA double helix? (21.3)
A: Replication :- process of formation of replica. where replica of DNA is formed so that the DNA could…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand?…
A: As per the general rule, the base adenine (A) always pairs with thymine (T) and the guanine (G)…
Q: Need to understand how to do this: create the complementary strand of DNA to the DNA strand provided…
A: DNA is a double helical structure that comprises of tel strand running in opposite directions. Both…
Q: A mutation results in the presence of multiple DNA fragments on the newly synthesized DNA strand…
A: DNA is a double helical structure made of two complimentary strands. The two strands in a double…
Q: What does a restriction enzyme do? O a) Delivers recombinant DNA to target cells. O b) Cuts DNA at a…
A: Recombinant DNA technology is the emerging branch in biotechnology which has a great potential. It…
Q: The replication of chromosomes by eukaryotes occurs in a relatively short period of time because ?…
A: The DNA replication is the production of new DNA from the old DNA by the semiconservative manner. In…
Q: atthew Meselson and Franklin Stahl performed an experiment using heavy isotopes and bacteria to…
A: The process of DNA replication is the process by which the genetic material of the organism copies…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5 -TGTCCCA-3'…
A: Nucleic acids are the biomolecules composed of nucleotide units. A nucleotide unit is composed of a…
Q: What is happening at letter "C"? O RNA Primase is laying down some RNA Primer on the lagging strand…
A: DNA replication is a process by which one parent DNA replicates to form two identical daughter DNA.…
Q: DNA polymerase III adds nucleotides to both ends of the RNA primer to the 5' end of the RNA primer
A: DNA is the genetic element found in all prokaryotic and eukaryotic cell types. DNA is a…
Q: What is the function of DNA gyrase? O a prevents the two complementary template strands from bonding…
A: DNA replication is the process of formation of replica of DNA. It involves various enzymes which…
Q: What is the role of DNA polymerase in DNA Replication? unwind and unzip the DNA repair errors reads…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…
Q: What determines the sequence of nucleotides in the template strand of DNA? (The answer can be very…
A: dna is the genetic material . it is formed via the polymerization of nucleotides . a dna molecule…
Q: DNA nucleic acids are held together by WEAK hydrogen bonds because...? A It was a mistake when being…
A: DNA is a double helix structure present in the nucleus of the eukaryotes.
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-AGCCTCG–3'…
A: When the structures of molecules or macromolecules match together in such a way that physical,…
Q: A technology called PCR is used for replicating large quantities of DNA in forensic science (Chapter…
A: Introduction PCR is the revolutionized technique invented by Karry Mullis in 1983, for which he got…
Q: Which best describes DNA polymerase? Group of answer choices an enzyme that removes the sugar…
A: There are several enzymes in the replication process such as helicases, ligases, DNA polymerase, RNA…
Q: Draw a picture of a DNA replication bubble. • Indicate the origin of replication, the leading and…
A: Since you have posted a question with multi subparts, we will solve the first three subparts for…
Q: AKS 5b: Use the image below to answer the question that follows. Below are the interpretations of…
A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is present in the…
Q: Which step of DNA replication occurs BEFORE DNA polymerase extends the new strand of DNA? - a…
A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…
Q: Vho first developed the DNA sequencing approach using dideoxynucleoside triphosphates in DNA…
A: DNA was major topic of discuss in early times for scientists. It's structure and constituents…
Q: DNA polymerases that corrects errors and mismatches in DNA is called? A. Post replication repair…
A: Although DNA replication is an extremely exact process, errors can occasionally happen, such as when…
Q: Reproduction of DNA Before DNA can copy itself the cell must make lots of extra A, T, G, and C. Then…
A: The process by which DNA is effectively doubled is known as DNA replication, also known as…
Q: What is the main function of DNA in living things
A: DNA is a big, complicated molecule that carries the genetic information that determines a live…
Q: 1. Explain how DNA encodes genetic information. 2. Explain the role of complementary base pairing in…
A: Explain how DNA encodes genetic information The arrangement, or sequence, of the nucleotides along…
Q: What is the function of DNA polymerase in DNA replication? to create replication bubbles by…
A:
Q: DNA replication is a semi-conservative process
A: In molecular biology, DNA replication is the process of synthesizing two identical copies of DNA…
Q: Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes…
A: Synthesis of DNA strand on pre-existing strand is termed as replication. It involves duplication of…
Q: Which pattern does the structures of dna follow in that its replication results in one parent…
A: The central dogma of molecular biology briefs that DNA has instructions to synthesise proteins which…
Q: At which point during DNA replication is genetic lost from the telomeres? Enzymatic action of…
A: Replication is the process of making two identical DNA molecules from a double-stranded DNA…
Q: How do amino acids in DNA-binding proteins interact with DNA? a. By forming covalent bonds with DNA…
A: The interactions between DNA and proteins are important for regulating events such as transcription…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 384 Answer all the questions below please! Required: At least 3-4 sentences for each answer Write answers in your own words (don't copy the answers directly) Choose one of the questions below to write a follow-up question Structure and Function of DNA and RNA Q2.1- Hydrogen bonds can form with bases on the opposite DNA strands in the double helix, or between the bases and H2O in the single stranded conformation. Considering that the double helix is the most stable conformation in water, how does this observation support the conclusion that base stacking contributes more to helix stability than interbase hydrogen bonding? Amino Acids and Peptides Q2.2-Using Table 4.3, list the amino acids that will carry a net charge at pH 7 within a protein. What is the charge at pH 7 for each of the amino acids you have listed (-2, -1, +1, etc.)? What is the net charge at pH 7 of the tetrapeptide shown in figure 4.17?McGraw-Hi P Question 17 B. What is happening at letter "C"? O RNA Primase is laying down some RNA Primer on the lagging strand O DNA Ligase is joining two Okazaki Fragments together O DNA Polymerase III is making a new DNA strand on the leading strand O DNA Polymerase I is removing RNA Primer and replacing it with DNA on the lagging strand Ouestion 18 11 MacBook Pri B.☆回 w Insert Format Tools Add-ons Help Last edit was yesterday at 8:08 AM TURN 100% Normal text Arial 11 BIUA E- 1E E E - E EX 2. 3 . 5. C Directions: Describe the process of DNA replication in the space below. Specifically reference the pictures in your answer. Your response will undergo a plagiarism check. Be sure to write your response in your own words. Be sure to reference and thoroughly explain: The relationship and importance of DNA replication and the cell cycle. The conservation of genetic information during replication. (Is it conservative? Semi-conservation? Dispersive? What does this mean?) The specific enzymes used in each step and indicate whether each of the enzymes is a synthesis reaction or a digestion reaction. Justify your answer through explanation. Identify the parameters and limitations of the enzymes working effectively. (What factors would limit or interfere with DNA replication?)
- - Addin X O Informational Rese X E credible source act X Y Muhammad | Biogr X W Muhammad - Brita X mi.instructure.com/courses/25527/assignments/4743473 Due Wednesday by 11:59pm Points 100 Submitting an external tool Your progress has been saved Question 1 of 9 Which of the following statements are true about DNA polymerase? Select all that apply. O On the leading strand, it works toward the replication fork. O It adds nucleotides from the 5' end of the DNA toward the 3' end. O On the lagging strand, it works away from the replication fork. O It starts replication at one end and then switches sides and continues on to the other strand. « Previouscommon-assessment-delivery/start/4797160920?action=onresume&submissionld%-468979669 English 9 Student D. S ddddddddddddddd... Type of Genetics Cr. S TEWWG Chapter DNA Protein Synthesis Test Chromosome Free Nucleotides DNA Polymerase Leading Strand Original- (Template DNA) Helicase Lagging Strand Replication Fork Adenine Thymine Guanine Cytosine DNA Polymerase Original (Template) DNA Strand 1. This diagram is showing the process of 2. 1f the original template strand reads: TTACGCAGT, DNA polymerase would add nucleotides in the order: 4 5 6 7 8. 9 10b. The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of replication. Please supply the specific pieces of information requested by the boxes below. 1. What enzyme relaxes the supercoils? 2. What enzyme unwinds the DNA? 7. What does this arrow represent? 3. What enzyme synthesizes the RNA primer 8. Why should this single-stranded portion be stabilized? 4. What is this short segment of DNA called? 9. What enzyme synthesizes this long DNA segment? 5. What enzyme removes the RNA primer and replaces it with DNA? 10. Is this the leading or the lagging side? 6. What enzyme joins the short segments of DNA together? 3
- Can you please check my answer and make sure it is correct. Question: List the ingredients of master mix, and state the purpose of each ingredient. Answer: Taq DNA polymerase This enzyme synthesizes the complementary strand of the DNA template after attaching to the primer. This means that it adds on free nucleotides to the existing strand, but helps speed up the covalent bonding between these newly added nucleotides. This enzyme is also thermally stable meaning that it can withstand the hot temperatures needed for PCR to occur. This hot temperature is needed for the denaturation step when the double stranded DNA has to be unwound and separated into two strands. Individual building blocks of DNA (either free nucleotides A, T, C, and G or dNTP’s) These nucleotides are needed to build the complementary strand of DNA A special buffer to maintain the optimal pH, salts, and MgCl2 These buffers help maintain a good pH that doesn’t become too acidic or basic for Taq DNA polymerase to…Match the enzyme or protein to the replication process. Record your answers onto the Google Form. a. DNA polymerase I b. DNA polymerase I| c. DNA polymerase III d. primase e. DNA ligase f. helicase 9. single-strand-binding proteins h. topoisomerase II 58. Unwinds helix and breaks hydrogen bonds to make a replication fork. 69. Removes RNA primer and replaces it with DNA nucleotides. 60. Joins together the fragments made on the lagging strand. 61. Adds a short segment of RNA to start replication. 62. Stabilizes newly unwound strands. 63. Catalyzes the addition of new nucleotides, one at a time. 64. Relieves strain of over winding created by replication fork. 65. Proofreads new nucleotide sequence for correctness.Answer the ff. questions: 1. At eukaryotic origins of replication, helicase cannot be activated until the polymerase is also positioned on the DNA. Explain what would happen if the helicase became active in the absence of DNA polymerase. 2. RNA synthesis is much less accurate than DNA synthesis. Why does this not harm the cell? 3. What is the role of folate in the synthesis of nitrogenous bases of purines?
- erm test Fall 2020 (page 1 of x A elearn.squ.edu.om/mod/quiz/attempt.php?attempt31335328&cmid%3D697149 -aming System (Academic) Fon 3 "DNA is passed from one generation to another during cells division after DNA replication". et red which of the following statements regarding DNA replication is NOT correct: d out of Select one: O a. Each DNA strand of the double helix will be copied g question O b. The newly synthesized strand will have the complementary sequence of the parental template strand O c. The daughter cell will have doub the amount of DNA that the parental cell had n 4 Which of the following ketoses contain the same number of carbons as glucose? ed Select one: out of O a. Sucrose O b. Fructose question O c. Ribose O d. Galactose O e. Aldose 5) helps maintaining the skin's cells and prevents the growth of someDNA WORKSHEET Use the following information to answer the next four questions. Nucleic Acid 3'TAGATTCCGATCGAAGGTTCCTAGCATGAACGATCAATTCCGG 1. Identify the type of nucleic acid found above. 2. Write the complementary strand for it. 3. If the replication fork occurs on either end of this strand open up the strand and place RNA primers in the appropriate places (one for the leading strand and two for the lagging strand). Using arrows show the direction of strand synthesis for each template strand and label each as leading for lagging strands. 4. If the RNA primer is four bases long identify the bases in the primer for each leading strand. The bases in bold indicate the location where the RNA primers would bind.F H. A B D H G OVERVIEW D 1. lagging strand 2. DNA polymerase v B 3. origin of replication 4. binding proteins V E 5. primase v F 6. ligase v G 7. leading strand V H 8. helicase Click Save and Submit to save and submit. Click Save AllAnswers to save all answers. > > > > > > > >