E14. A sample of DNA was subjected to automated DNA sequencing and the output is shown here. WWww MWWWwW.INY G = Black A = Green T = Red C= Blue What is the sequence of this DNA segment?
Q: Transformation can be described as Polymerase chain reaction Sanger Sequencing Use of…
A: DNA is one of the genetic material present in the cell. The cell is modified by inserting the…
Q: purpose(s) of DNA extraction
A: The purpose of DNA extraction are: To study the genetic cause of the disease. For the development…
Q: How many subunits does the E. coli DNA polymerase I have? Select one: O a. 5 Оb. 10 О с. 1 O d. 3
A: RNA polymerase is required for the transcription of DNA into RNA. It is also important in the study…
Q: The enzyme that proofreads the new strand of DNA, looking for and correcting mistakes as it…
A: DNA replication is the process in which the two identical replicas of DNA from one original DNA…
Q: The function of a restriction enzyme is to a. prevent the movement of DNA outside the nucleus b.…
A: Restriction enzymes:- these are the proteins and mostly isolated from prokaryotes. These enzymes…
Q: Which DNA polymerase in prokaryotes is involved in the replacement of primers with deoxynucleotides?…
A: DNA polymerase is the enzyme that catalyses the replication of DNA. DNA polymerase cannot synthesise…
Q: DNA gyrasea. promotes negative supercoiling.b. relaxes positive supercoils.c. cuts DNA strands as…
A: Deoxyribonucleic acid (DNA) replication is the biological process of producing two identical…
Q: utline the four broad classes of chemical damage to DNA.
A: Epigenetic mechanisms are described in detail. Multiple biological processes that affect epigenetic…
Q: Describe the basic features of recombinant DNA, the polymerase chain reaction, and DNA fi…
A: Introduction: The direct modification of an organism's genes using biotechnology is known as genetic…
Q: Which of the following statements is accurate for DNA replication in your cells, but not PCR? a.…
A: BASIC INFORMATION ABOUT GENETIC MATERIAL DNA It stands for deoxyribo nucleic acid. It is the…
Q: Recombinant DNA construction involvesa) Cleaving DNA with restriction endonuclease and joining with…
A: Genetic engineering is the branch of biological science that can input alteration of DNA in an…
Q: From among only the following, the THIRD step in DNA replication is Primase produces an RNA primer…
A: Primase creates an RNA primer, which is a brief stretch of complementary nucleic acid that serves as…
Q: DNA polymerase III is a processive enzyme, which means that a. it does not dissociate from the…
A: Ribonudeic acid is produced by an enzyme called RNA polymerase, which is responsible for the…
Q: h of the following is NOT true of cutting DNA in biotechnology? A molecular biologist can cut DNA…
A: Biotechnology is a technique in which DNA is manipulated either by cutting the the and required gene…
Q: What to restriction enzymes do? O They cut at specific locations on both strands in the…
A:
Q: library contains a collection of DNA clones derived from MRNAS. library contains a collection of DNA…
A: Genomic library is a library which encompasses the entire genome. Genomic Library involves the…
Q: DNA replication is said to be semiconservative because a. one of the new molecules conserves both of…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in: A) Recombinant…
A: VNTRs are repeated units that occur in the genome and display length variations. The VNTRs consist…
Q: DNA cloning isa. making multiple genetically identical cells.b. making multiple copies of a piece of…
A: Molecular biology deals with the molecular basis of the cells including the synthesis,…
Q: The purpose of using a washing soap in DNA extraction experiment is to O a. Lyse the cells to…
A: DNA extractions is a method to isolate DNA from the nucleus of given cell culture. The four steps of…
Q: 1. This image summarizes how computers sort and order DNA fragments to produce a final sequence of…
A: Nucleic acid is chemically different than protein and carbohydrate . This difference helps in…
Q: Recombinant DNA is:(a) DNA that is produced when genes from one kind oforganism are introduced by…
A: A gene is an essential unit of heredity and a sequence of nucleotides in DNA or RNA that encodes the…
Q: 5. Below is an image of DNA sequenced using the Sanger sequencing method, where different…
A: Gel electrophoresis is a molecular technique that aims to separate the DNA, RNA, and protein…
Q: The enzyme ________ separates the TWO DNA strands of the double helix. a. helicase b. ligase…
A: Deoxyribonucleic acid (DNA) is the functional genetic information-carrying molecule present in cells…
Q: DNA Polymerase holoenzymes used for DNA replication recognizes A. double-stranded sequences as…
A: DNA polymerase III holoenzyme (Pol III HE) is an enzyme that catalyzes elongation of DNA chains…
Q: Once separated from other cellular components, extracted DNA can be used for a variety of purposes.…
A: Introduction:- Biotechnology relies heavily on the extraction of DNA. It serves as the foundation…
Q: Which of the following best explains the production of Okazaki fragments in replicating DNA (a) DNA…
A: Okazaki fragments also known as lagging strand in DNA replication is a strand whose RNA primers are…
Q: In enzymes cut DNA into fragments, which are separated by size to form a pattern of bands. O…
A: In DNA fingerprinting , restriction enzyme are used to cut DNA into smaller fragments. Then these…
Q: The bacterial repair system that corrects mismatched bases after polymerization is able to…
A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…
Q: What does a restriction enzyme do? O a) Delivers recombinant DNA to target cells. O b) Cuts DNA at a…
A: Recombinant DNA technology is the emerging branch in biotechnology which has a great potential. It…
Q: Ultraviolet light principally causes which of the following dmages to DNA? A methylation of specific…
A: UV light can kill cells by damaging DNA to an irreversible extent. The light initiates reaction…
Q: fa restriction endonuclease recognizes and cleaves a linear piece of DNA and Circular DNA at 8…
A: Restriction endonuclease These are also known as restriction enzymes. These enzymes have been…
Q: Describe the activities of the enzymes required to construct a recombinant DNA molecule.
A: Genetic engineering is the major area for the production of recombinant DNA. The recombinant DNA is…
Q: What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5…
A: DNA stands for deoxyribonucleic Acid. It is a long polymer of deoxyribonucleotides. It is found in…
Q: he purpose of using a washing soap in DNA extraction experiment is to D a. Cut the proteins away…
A: DNA stands for deoxyribonucleic acid. It is present in the nucleus of the cell It stores genetic…
Q: 1. The polymerase chain reaction (PCR) is used by scientists to amplify DNA, particularly when the…
A: We are answering 1st question only. For the rest of the questions please repost. The polymerase…
Q: A linear piece of DNA is cut as follows: cut with Ecorl - get 1kb and 4 kb band Cut with Bamhl - get…
A: Ans- According to question For linear DNA – Upon Cutting by for Eco R1 it formed – 1kb and 4kb =…
Q: The leading strand in DNA replication requires only one primer for its synthesis. The lagging strand…
A: DNA replication is the semi-conservative process in which each strand of DNA molecule act as a…
Q: Which of the following items do not affect the melting temperature of DNA? A length of the DNA B the…
A: Melting temperature ( Tm): half of DNA gets denatured (melts). Tm = 2* (A+T) + 4* (G+C)
Q: What is a DNA Ladder? a solution added to a DNA sample to give it color for an electron microscope.…
A: DNA: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic…
Q: The DNA molecule is replicating. Below are four DNA fragments. DNA Fragments: 1. CGATCT 2. TCACGA 3.…
A: The Nucleotide polymers that are responsible for determining and regulating the genetic…
Q: The direct manipulation of genes is called O genetic engineering O DNA sequencing nucleic acid…
A: Gene can be defined as a unit of heredity.It is a segment of DNA(nucleotide sequence)that may…
Q: Which of the following is/are not required for DNAreplication to occur?a. DNA polymerase d.…
A: DNA (short for deoxyribonucleic acid) is a double helical structure (with two DNA strands). A…
Q: 1) What is the size of the following single-stranded piece of DNA? ATCGTGTGCT A) 10 b B) 20 bp C) 20…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: The extraction of DNA is a common procedure in biotechnology research laboratories. Research the…
A: Common DNA extraction methods Different extraction methods result in different yields and purity of…
Q: Which of the following is not required for Sanger sequencing of DNA? OA. ddNTPs B. DNTPS C. A DNA…
A: Sanger sequencing is a method of DNA sequencing.It involves selective incorporation of chain…
Q: DNA A= 5' GGG GCT AGC CCC 3' DNA B=3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC…
A: A hairpin loop has a stem that contains complementary bases and a circular structure that does not…
Q: Use the set of gene sequencing results below to answer the question that follows: A G C T -Wells I…
A: Gel electrophoresis is a laboratory method used to separate mixtures of DNA, RNA, or proteins…
Q: DNA polymerase III requires a(n)__________ for synthesis of DNA to occur A- DNA template B-RNA…
A: DNA polymerase III binds with the primers on the leading and lagging strand and synthesize new DNA…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹39) The diagram to the right represents one technique used in biotechnology. The organic compound used to cut the bacterial DNA so that the human DNA could be inserted a(n)Draw an Illustration of the steps and other methods involved in recombinant DNA ( Please make it clean and readable, labelled should be included).[ Drawing ]
- A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment, and set up a series of four dideoxy reaction. You then separate the products of the reaction by gel electrophoresis and obtain the following banding patter: ddATP ddTTP O 5'-ATTCGACT-3' O 5'-TCAGCTTA-3' What is the base sequence of the synthesized fragment? O 5'-AGTCGAAT-3' ddCTP O 5'-TAAGCTGA-3' I ddGTP. Explain how gel electrophoresis is used to separate DNA fragments of different lengths.Explain Shortly. I need help The emergence of new molecular biology techniques has allowed researchers to determine DNA sequences quickly and efficiently. A) How could knowledge of a DNA sequence be abused? B) How could knowing a DNA sequence be helpful? C) Would you ever consent to having your DNA sequenced. Explain your answer
- Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGACBelow is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment, and set up a series of four dideoxy reaction. You then separate the products of the reaction by gel electrophoresis and obtain the following banding patter: ddATP ddTTP ddCTP ddGTP What is the base sequence of the original fragment that you were given? 5'-TAAGCTGA-3' O 5'-ATTCGACT-3' O 5'-TCAGCTTA-3' O 5'-AGTCGAAT-3'
- Can you explain thie each of the statement given i dont really understand the dna recombinant is used as a molecular cloning and application for recombinant dnaPart 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a) HpaI, recognizes 5’ GTT – AAC 3’ 5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’ Number of fragments of DNA:…SC DF eas fill The diagram below illustrates how recombinant DNA technology is used to produce valuable products. What is the purpose of using restriction enzymes in recombinant DNA technology? PDF UNOFFIC TRANSCR ostly cloudy DNA plasmids OO Bacterial cell (E. coli) Bacterium with recombinant DNA plasmid Plasmids isolated OO DO Cloned cells produce new protein such as enzymes or hormones O-C Ligase joins sticky ends Replication of new gene 00 00 Restriction enzyme cuts plasmids Sticky ends Gene obtained from donor DNA using the same restriction enzyme O The restriction enzymes are used to catalyze the synthesis of new proteins such as enzymes or hormones. Sticky ends O The restriction enzymes are used to join sticky ends of both the cut plasmid and the cut gene obtained from donor DNA PI mas omis O Search