Which statement is correct? OA cap is removed from the 5' end of a DNA molecule A сар A poly-A tail is added to a DNA molecule OA cap is removed from the 5' end of a pre-mRNA molecule OA poly-A tail is added to a pre-MRNA molecule

Q: What are the nucleotides of the mRNA from gene Z?

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: CN12 Hypoglossal

A: The twelve pairs of nerves that arise from the brain and function to connect the brain with several…

Q: Answer please don't copy

A: The structures within the human body are maintained at several levels of structural organization.…

Q: Place the following levels of human structure in the correct order with 1 being the smallest and 8…

A: Animals present in the animal kingdom is formed of numerous cell . Various life processes are…

Q: D C ши I H_

A: We are given an unlabeled diagram of a cross section of flower. We have to label the diagram.

Q: How does this organism obtain it's carbon? Autotrophic via photosynthesis Heterotrophic via…

A: The picture is showing the organism having chlorophyll in it. Because there are found green colour…

Q: Description not drawn?

A: Plasmodium is a malarial parasite and the life cycle of plasmodium requires two hosts: A female…

Q: What do I write for B,C,D

A: Plant cells are photosynthetic eukaryotic cells found in green plants, which belong to the Plantae…

Q: How does aposematism differ from cryptic and mimicry. What purpose does it serve.

A: Many plants and animals employ different mechanisms to protect themselves from their…

Q: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA

A: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA Know that, The Adenine is always pairs…

Q: B A E D N F MIIC M K

A: Introduction: A group of genes that code for proteins found on the surfaces of cells that help the…

Q: What do you mean by tracrRNA?

A: Ribonucleic acid (RNA) is a single-stranded helical structure composed of a ribose sugar,…

Q: Define I band

A: The striated muscles have two types of protein fibers involved in the mechanism of muscle…

Q: A

A: The heart pumps deoxygenated blood from different parts of the body to the lungs and pumps…

Q: BUILDING RELATIONSHIPS

A: Communication:Openness: Be transparent and honest in your communication. Share your thoughts and…

Q: Above Below Q A Q B C D

A:

Q: LT-C14, Half Head with Musculature. 38 Scientifice The deepest lobe of the highlighted structure is…

A: The highlighted structure is the cerebrum that is the largest part of the brain. It is divided into…

Q: What is TEE?

A: A transesophageal echocardiogram (TEE) is a type of echocardiogram test that is performed via the…

Q: name the feature (blue circle)

A: The skeletal system is one of the 11 major body organ systems that are concerned with various…

Q: Lebel 1

A: We know that It is the largest bone in the body. It is the bone present on the upper end of the body…

Q: HR VS Sem's O 150 005 Rhythm fifififif 1252, 20 jufifufuful

A: ECG states electrocardiogram. It is a non invasive diagnostic procedure. It is used to record the…

Q: Appendicular S

A: Bone is a metabolically active connective tissue that aids in mobility, protects essential organs,…

Q: 2. Next, directly below the new DNA sequence that you gave for #1, write/type the nucleotide…

A: 2. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Which letter corresponds to the kinocilium? D' 100% 29°F

A: Introduction: Organ of Corti is located in middle cochlear canal in the inner ear. It has hair-like…

Q: The suffix refers to tissue or structure.

A: The suffix "-ium" in medical terminology is used to form nouns that refer to a specific structure or…

Q: Pick the Correct term for the Label: A O Anticodon O Codon Ribosome O Protein Chain OmRNA O tRNA O…

A: The translation is the process in which proteins are synthesized by ribosomes. Translation occurs…

Q: Fibrocartilage (____×)Location _______________________ Function _______________________

A: As we know human body is made of skeleton. Skeleton is structure that keeps body in shape and helps…

Q: Which letter represents the corpus spongiosum? -B -D OD O A CDE

A: Introduction: The male reproductive system comprises the following: A pair of testis Accessory…

Q: attach

A: The given diagram is of ANTIGEN PRESENTATION to a defence cell of the body so that it recognises the…

Q: A,

A: Meosis is the type of cell division which resukts in the formation of the gamete.  In humans the…

Q: leptin i

A: Erythropoetin is a hormone which is responsible for the production of RBC

Q: What does the word "deppresion" really mean

A: Depression is a mental health disorder that affects a person's mood, thoughts, and behavior. It is a…

Q: HO- HO HN-CO- но-

A: Teicoplanin is a semisynthetic glycopeptide/peptidoglycans antibiotics that is used in the treatment…

Q: QUESTION 8 Name the tissue. Be specific. 400X

A: Answer 8. The highlighted structure is the Nervous Tissue. Nervous tissue consists of neurons (nerve…

Q: Label A and B asap

A: We can say that Blood is a fluid tissue that transports oxygen and nutrients to all parts of the…

Q: Explain DKA

A: Diabetes mellitus is a physiological condition in which blood sugar levels are higher than normal…

Q: A BCDE C. D FGH K

A: The diagram represents the skeletal muscles located on the posterior surface of the human body.…

Q: what are the Hoya wax flower production techniques

A: Hoya wax plant is a flowering plant belongs to a family known as Apocynaceae. The scientific name of…

Q: Letter D please what is called!

A: The smallest structural and functional unit of an organism is known as cell which contain different…

Fungal Infections

Fungal infection can be defined as an infectious disease caused by fungi. A fungal infection is also referred to as mycosis. Fungal infections are contagious, spreading from person to person. Mycosis can be contracted even from an infected animal or contaminated soil. The most common symptom is skin rashes and vaginal discharge in females.