Which of the following rows identify the type of mutation and the process in protein synthesis that is most affected by an insertion of a nucleotide in a gene that codes for a ribosome? Select one: a. Mutation Process Frameshift Translation b. Mutation Process Frameshift Transcription c. Mutation Process Substitution Transcription d. Mutation Process Substitution Translation

Q: Evaluate the following statements. Which one statement is false?

A: Answer: Central Dogma : It is the complete process of replication , transcription and translation of…

Q: The following image represents a gene model. Which part is (are) exon(s)? type your answer... Which…

A: Eukaryotic protein-coding genes are segments of DNA in eukaryotic organisms that contain…

Q: a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand…

A: The ribonucleic acid was the primary genetic material. It acts as a genetic material furthermore as…

Q: You are studying a human cancer cell line and you notice that you see the normal amount of RNA but…

A: INTRODUCTION Mutation Mutations are the sudden heritable changes in the genetic material occur due…

Q: 2.5 Which of the following is true about translation? A) The anticodon in the transfer RNA is…

A: t- RNA is called transfer RNA which changes to amino acyl RNA with help of the aminoacyl t-RNA…

Q: 3 ‘  TACGCCAGTGGTTCGCAC  5   Give the base sequence of the complementary DNA strand.  Give…

A: Base sequence of template strand this 3 ‘  TACGCCAGTGGTTCGCAC  5 is  5' ATGCGGTCACCAAGCGTG 3'   mRNA…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Explain point  mutations and frameshift mutations. Which is more apt to disrupt the  structure and…

A: Proteins are the expression of the information present in the DNA (deoxyribonucleic acid). This…

Q: The word mutation is generally considered to be negative. However, is there a positive side to…

A: MUTATION:- a mutation refers to a change in a DNA sequence.it can result from Dna copying mistakes…

Q: Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the…

A: Introduction Gene expression is the process through which a gene's information is used to create a…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: suppose that a gene has a mutation that changes one nucleotide. Because of this one nucleotide…

A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…

Q: Which of the following terms refer to the case when a mutation results in a significant decrease or…

A: The chenge in DNA sequence of an organisms is known as mutation.

Q: Use the description of the FGFR3 and your knowledge of protein synthesis to explain how this…

A: FGFR3 stands for fibroblast growth factor receptor 3. It is found in the cell's membrane and sense…

Q: Complete each of the following statements by selecting from the bank of terms below. a. tRNA b.…

A: 81)Redundancy 82)Universal  83)Elongation  84)Promotor 85)RNA processing  86)snRNA 87)tRNA

Q: B-thalassemia is a hereditary blood disorder that leads to the formation of an abnormal hemoglobin…

A: Answer is  option A.

Q: 7) The protein VEGF plays an important role in stimulating the formation of new blood vessels. In…

A: VEGF ( vascular endothelial growth factor ) is responsible for the growth of new vessels. In…

Q: Mutations that occur at the end of a gene may alter the sequence of the gene and prevent…

A: Transcription is one of the defined steps of gene expression and precisely refers to the formation…

Q: GIVE A SHORT ANSWERS TO QUESTIONS GIVEN BELOW  Why Phosphate bond is important in DNA or RNA…

A: Phosphate bond are important because structural framework of nucleic acid the energy for producing…

Q: After transcription has been completed in eukaryotes, the mRNA molecule first goes through some…

A: Nucleus is main controller of the cell which carries genetic instructions . It contain thread like…

Q: A mutation in the coding region of a gene may alter the of the gene. protein-coding region may alter…

A: Mutations are changes in the DNA sequence of an organisms genome. DNA is the genetic material that…

Q: Use the Genetic Code below to help you answer the following questions.  The nucleotide sequence of…

A: Mutation is the change in the genetic makeup of the organism, mutation particularly in the genes can…

Q: a. Identify the sequence that was mutated by the scientists and explain your reasoning. b. What…

A: Ans) a)A mutant protein is the protein product encoded by a gene with mutation. Mutated protein can…

Q: DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!)       tRNA anticodon (No thymine in…

A: According to Bartleby guidelines, the first three questions have been answered. Kindly post the…

Q: You’re working in Marshall Nirenberg’s lab, trying to decipher the genetic code. You use several…

A: Marshall Nirenberg studied the genetic codes for protein synthesis in his biochemical research. He…

Q: Which type of point mutation does not affect the resulting protein? a deletion b missense mutation…

A: A mutation is any alteration or change in the sequence of the genetic material (DNA or RNA). A point…

Q: A protein is normally secreted from the cell. A team of scientists attempts to redirect this protein…

A: Mutation can be defined as a change in the DNA sequence of a gene. In this case, a team of…

Q: Which of the following types of mutations would be predicted to harm an organism? explain your…

A: Introduction:- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…

Q: Albinism is a condition where individuals can't make melanin pigment. The affected gene encodes for…

A: Albinism is a group of inherited disorders which can lead to no production of melanin pigment due to…

Q: Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: a mutation occurred in the g of the codon below and the G became a C   A  T  G Changes to A  T  C…

Q: Identify the best match between the mutation description and term.   a. Transversion: results in a…

A: Often mutation occurs in our body. These mutations can be beneficial or lethal. The mutation occurs…