Which of the following provide clues that a particular DNA sequence is part of protein-coding gene? O The predicted translation product is homologous to previously identified proteins The sequence is found in a genomic library An identifiable intron/lexon structure that creates an open reading frame The sequence is transcribed O The sequence is found in a CDNA library

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…

A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…

Q: Which of the following is not a term used to describe an unspliced mRNA? intronic mRNA O primary…

A: In eukaryotic genes, non coding DNA is also present. In most of the eukaryotic genes, coding…

Q: Describe the process by which the information in eukaryotic gene is transcribed and translated into…

A: Eukaryotic gene expression is a complex process that involves transcription as well as translation.…

Q: After transcription, how is mRNA processed in eukaryotes?  (Choose all that apply) 3' polyA tail is…

A: TRANSCRIPTION It is the formation of mRNA from DNA. The mRNA formed has to undergo various…

Q: codons are part of the molecular structure of

A:

Q: Which of the following region is not found in the Eukaryotic RNA? 3' UTR Introns Intercistronic…

A: Eukaryotic RNA refers to the ribonucleic acid (RNA) molecules found in eukaryotic cells. Eukaryotic…

Q: This molecule makes up part of the structure that binds to an mRNA molecule to initiate…

A: Note: The process given in the question is assumed to be translation and not transcription.  DNA…

Q: Human Fbh1 helicase is important in the process of DNA replication. When a muta occurs during the…

A: Introduction : 1) DNA replication is the process by which the genetic material is copied within the…

Q: Match the following molecules to the correct description. DNA [ Choose ] [Choose ] exons, introns…

A: DNA- deoxyribonucleotides tRNA- anticodon and amino acids rRNA- ribosomes and protein translation…

Q: The sequence below is an mRNA strand that is in the cytoplasm ready to translated by a ribosome. If…

A: Translation is the process of formation of a protein chain from a RNA chain. Translation requires an…

Q: The molecule(s) that actually recognize and translate the genetic code into polypeptide sequence are…

A: Translation of genetic code into polypeptide chain is called translation.

Q: Which of the following are involved in transcription? O RNA polymerase DNA amino acids TRNA acetyl…

A: In translation mRNA, tRNA, rRNA, Amino acids, ribosome, acetyl transferase are required.

Q: In Figure 14-9, how are the positions of codonsdetermined?

A: Ans: Codon: The set of trinucleotide sequence of DNA or RNA is referred to as codon.

Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, rRNA, and…

A: RNA or ribonucleic acid is a molecule which play a significant role in expression of genes via…

Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…

Q: Which of the following RNA molecules is responsible for carrying the code that will be read at the…

A: BASIC INFORMATION  TRANSCRIPTION  it is responsible for the formation of hnRNA which has the codes…

Q: which of the following causes transcription to end? RNA polymerase reaches the terminator RNA…

A: Many processes occur within the cell for its normal functioning. They include replication,…

Q: Part A Which of the following processes is represented in the figure below? 3' AAG UGA RF1 RF2 O…

A: Thank you for the question  Answer :- The given picture shows translation termination Explanation :-…

Q: Name (Last, First): DNA An RNA Polymerase attaches to the DNA and transcribes the DNA to mRNA…

A: Introduction  Gene expression is the process through which a gene's information is used to create a…

Q: The genetic code is made of 3 RNA nucleotides read 3-->5' 3 RNA nucleotides read 5'-->3' 3 DNA…

A: In molecular biology, the central dogma controls the process of transcription in which DNA is…

Q: Classify the following functions or structures as being attributed to proteins, RNA, or RNA-protein…

A: A. Proteins -  Poly A polymerase Release factors (RF1 and RF2) Formation (catalysis) of peptide…

Q: The following base sequence is a complete polynucleotide made in a bacterial cell. AUG, GCC, AUG,…

A: The process of transcription entails creating mRNA from a DNA template. A complementary mRNA strand…

Q: Coding strand: Template strand: 5' AAGACCTATATAATGACGAACGATATT 3 3 TTCTGGATATATTACTGCTTGCTATAA 5

A: Transcription is the process that synthesis the mRNA transcript from the double-stranded DNA by the…

Q: What type of RNA corresponds to the statement? Prokaryotic Eukaryotic FRNA MRNA TRNA hnRNA RNA FRNA…

A: RNA or Ribonucleic acid is one among different biomolecules. They are also composed of nucleotides;…

Q: Which of the following is NOT a property of the genetic code? O It specifies the amino acids within…

A: The genetic code is the set of rules that govern how the nucleotide sequence of DNA is translated…

Q: A codon is: three amino acids on a polypetide that are snipped off by the helicase enzy O sets of…

A: There are total of 64 codons coding for Amino acids.

Q: Polypeptides can be reversed back to RNA because of the enzyme transcriptase. The genetic material…

A: The expression of the genetic material occurs generally through the production of proteins. This…

Q: Of the options listed below, which one set of features determines the length of the primary RNA in…

A: Primary RNA also called heterogeneous RNA  (hnRNA)  consists of both coding sequence (exon) and…

Q: Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of…

A: Transcription is the process by which the information in a DNA strand (template) is copied into a…

Q: Refer to the following illustration to answer the question. mobile genetic elements exon 1A…

A: Transposable genetic element are the DNA sequences which can shift their original locations and…

Q: Is the answer mRNA or Exon?

A: The following are further details about  each option: Exons:Incorrect.Exons are the coding regions…

Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the processed mRNA transcript…

A: Gene is the sequence of nucleotide that encode a particular amino acid. It is found in DNA.

Q: Look at the MRNA strand below. There are at least a few bases before the "AUG" or the start codon.…

A: Several codons or triplet bases make up the universal genetic code. Over time, the standard code has…

Q: DNA Sequence mRNA Sequence (codon) tRNA Sequence {anticodon) AMINO ACID Sequence

A: Introduction DNA (Deoxyribonucleic acid)serves as the genetic material of almost all organisms (some…

Q: Which of the one of the following parts of the gene will NOT be included in the RNA it encodes?…

A: The process of formation of RNA with the help of DNA is called transcription. this process is…

Q: Which of the following would be most likely to have a dramatic effect on the amino acid sequence of…

A: The protein is a sequence of amino acids. The two amino acids are joined by peptide bond.

Q: Below is an mRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz…

A: This mRNA sequence have so many genetic code. There are some numerical value on genetic code but all…

Q: Which one of the following features of a generalized structure of a eukaryotic gene is not copied…

A: The process of copying a gene's DNA sequence into a messenger RNA (mRNA) by the enzyme RNA…

Q: Construct a polypeptide chain by translating the given red strand of the mRNA segment.…

A: Translation It is defined as the process of protein synthesis in which the sequence of mRNA is…

Q: Translate the protein that is expressed from this template DNA sequence. Transcription is going left…

A: Transcription is the process of formation of mRNA from a DNA transcript. It occurs ont he template…

Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the primary mRNA transcript…

A: The mRNA is produced by the process of transcription.

Q: 1. What nitrogenous base is found in position Y? 2. What nitrogenous base is found in position X? 3.…

A: Nucleotides are the building blocks of DNA and RNA. The process of transcription produces messenger…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.