Which of the following phenotypes is an example of a temperature-sensitive conditional mutation? Siamese cats O Tay-Sachs O Phenylketonuria O Achoncoplasia O Porphyria
Q: We often speak of diseases such as phenylketonuria (PKU) andachondroplasia as having a genetic…
A: When the disorder is caused by the mutation in a gene or multiple gene or by combination of the gene…
Q: In fruit flies, the autosomal recessive mutation pr causes brown eyes whereas the cn mutation causes…
A: A genetic characteristic or disease can be handed down from one parent to the next through autosomal…
Q: One of the most famous cases of an X-linked recessive mutation in humans is that of hemophilia found…
A: Hemophilia is a bleeding disorder in which the blood lacks clotting factors. It is X-linked…
Q: Factor XI deficiency is a heritable blood-clotting disorder caused by an allele that received which…
A: Factor XI is also known as plasma thromboplastin antecedent.
Q: Achondroplasia is a rare form of dwarfism. It is caused by anautosomal dominant mutation within a…
A: Achondroplasia is a disease caused by an autosomal dominant mutation in the FGFR3 gene, which codes…
Q: Fill up the blank __________s are blood diseases caused by mutationsthat eliminate or reduce the…
A: The blood is the fluid connective tissue that is essential for the transport of oxygen,…
Q: A mutation results in an enzyme that is partially active compared to the wild -type allele. This…
A: A mutation is the alteration of the nucleotide sequence of the genome of an organism, virus or…
Q: The expression of antigen A or antigen B in red blood cells requires the help of an H antigen. A…
A: Given information Antigen A and antigen B in red blood cells need H antigen for expression. A…
Q: How will this mutation affect descendants of this puppy? O The mutation will cause a genotypic…
A: Mutation is the permanent change that occurs in the DNA segment of DNA. It can occur due to several…
Q: Mitochondrial DNA is often used to trace lineage and identify the origin of the human species…
A: Mitochondrial mutation - It is a mutation in which mitochondria is disrupted . It is an organelles…
Q: Tay–Sachs disease is a severe autosomal recessive genetic disease that produces deafness, blindness,…
A: Tay-Sachs disease is a neurodegenerative disease that is caused by the mutation of the gene HEXA…
Q: Which of the following is NOT a genetically engineered animal? Lütfen birini seçin: O a. Sheep…
A: Most of the options given above are animals produced trans-genetically. Transgenetic animals are…
Q: Select all the possible mutation types for the following observed phenotype resulting from a…
A: Need to find which of the following mutation is happened in protein to express in wrong cell
Q: This is a conjectural question— there is no single “right” answer— that is good for discussion over…
A: The human genome project can be used to sequence the DNA of every human gene.
Q: Opsin proteins detect light in photoreceptor cells of theeye and are required for color vision. The…
A: All the three species mentioned in the question that is The nocturnal owl monkey, the nocturnal bush…
Q: Gene mutations can be classified in two major ways: (1) hereditary or germline mutations that are…
A: Gene is the sequence of nucleotides that encode a particular protein.
Q: Which of the following are associated with dynamic mutations? O Genomic imprinting O Trinucleotide…
A: First of all we will discuss that, what is dynamic mutation and its causes. Dynamic mutation is the…
Q: . Usually, the deletion of a gene results in a recessive mutation. Explain how the deletion of an…
A: A recessive mutation is one in which the mutated gene has to be present on both of the homologous…
Q: hich of the following best explains how individuals who inherit phenylketonuria alleles can avoid…
A: Phenylketoneuria is a rare genetic condition in which a person is unable to dogest the amino acid…
Q: Is each of the following traits or diseases determined by nuclear genes?A. Snail coiling patternB.…
A: Nuclear inheritance- When offspring inherit a combination of nuclear chromosomes from each parents…
Q: n some organisms, the appendix is an important structure for digestion. In humans, however, the…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: In humans, the presence of an SRY gene commits a developing embryo to the female sex. indicates the…
A: SRY gene is a DNA binding protein that is responsible for the initiation of male sex determination…
Q: Alpha-1 antitrypsin has codominant inheritance. M genes express normal levels. S and Z genes have…
A: Emphysema is caused by deficiency in Alpha 1 antitrypsin.This disorder causes lung diseases and…
Q: Which of the following is NOT correct about recombinant human insulin? Lütfen birini seçin: O a.…
A: Insulin is a peptide hormone produced in pancreas by the beta cells of Islets Langerhans in the…
Q: cyndi grows thousands of b.rapa plants from seed and carefully watches for any unusual plants that…
A: Suppose the rosette plant is recessive one then when it crossed with the normal plant then in the F1…
Q: A rare dominant mutation expressed at birth was studiedin humans. Records showed that six cases were…
A: Answer : Since 2 cases were the ones which already had the mutation already present in their…
Q: people with osteogenesis imperfecta have a dominant mutation in one of the two genes that produce…
A: Mutation - Mutation is defined as the sudden change or alteration in the DNA sequence. Mutation is…
Q: “Bt maize”(A) is resistant to various herbicides, making it practical toweed rice fields with those…
A: Genetically modified organisms are the plants or animals or microorganisms in which the DNA or the…
Q: Which of the following statements is true regarding the phenotypic effects of inversions? Select ALL…
A: Inversion Inversion is a kind of mutation in the chromosomes where part of a chromosomes is cured…
Q: Which of the following molecules can be considered a direct product of genes within a cell? O a.…
A: Genes are the functional segments of DNA.
Q: If the effects of mutations 1 +3 is an eye size intermediate between wild type and mutation 1 alone,…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: cyndi grows thousands of b.rapa plants from seed and carefully watches for any unusual plants that…
A: According to question Rosette is a recessive mutation. B.rapa is an annual plant. And Cyndi crosses…
Q: eye colour body colour wing type -4 map units 6 map units 10 map units Refer to the illustration…
A: Linkage is the close association of genes or other DNA sequences on the same chromosome. Genes which…
Q: As a hobby you propagate a population of worms. You notice that one worm is now clear instead of…
A: Deletions are mutations in which a section of DNA is lost, or deleted. Since protein-coding DNA is…
Q: ________ are a commonly used research model for studying the effects of genetic defects in mammals.…
A: For studying genetic defects in mammals, model organisms are used. Generally, model organisms are…
Q: linical or phenotypic heterogeneity, in which different mutations in a gene may result in different…
A: Ans- true
Q: If the effects of mutations 1 + 3 is an eye size intermediate between wild type and mutation 1…
A: In biology, a mutation is an alteration in the nucleotide sequence of the genome of an organism,…
Q: What
A: Genomic imprinting:- A phenomenon in which expression of an allele in offspring depends on whether…
Q: myoglobin and alpha globin in humans O orthologous genes O paralogous genes pseudogenes O all of…
A: a. Homology means similarity between the characters as it is shared from the ancestry and its forms…
Q: In fruit flies, black body type is a recessive variant of the wild-type brown body. You cross two…
A: Introduction:- A mutation is an heritable change that occurs in the DNA sequence, either due to…
Q: Among mammals, measurements of the rate of generation of autosomal recessive mutations have been…
A: Scientists analyze mutations in model organisms such as mice, to understand the molecular basis of…
Q: A human gene called the β-globin gene encodes a polypeptidethat functions as a subunit of the…
A: AS per our honor code, we are allowed to answer only one question with a maximum of three-subparts.…
Q: Tay-Sachs disease is caused by loss of function mutation in a gene on chromosome 15 that codes for…
A: Tay Sachs disease is a disorder in which the nerve cells present in the spinal cord and brain are…
Q: Parents who both have "sickle-cell trait", i.e, are heterozygous for HbS have a child who is tested…
A: Sickle cell anemia is a blood disorder in which a mutation in one the hemoglobin genes causes the…
Q: Which of the following sets of genes are most likely to have pleiotropic effects?…
A: Pleiotropy is defined as a process in which one gene influences two or more two phenotypic traits.…
Q: To play Jeopardy, the answer is given. You must supply the questie best question for the following…
A: While mendelian genetics helps us understand the inheritance of normal genes there are certain…
Q: The MC1R gene affects skin and hair color in humans.There are at least 13 polymorphisms of the gene…
A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…
Q: How are the genes in the beta-globin locus different from each other? They have different…
A: Beta-globin is a subunit of hemoglobin, a larger protein found within red blood cells. In adults,…
Step by step
Solved in 3 steps
- Achondroplasia is an autosomal dominant form of dwarfism caused by a single gene mutation. Calculate the mutation rate of this gene given the following data: 10 achondroplastic births to unaffected parents in 245,000 births.Correct answers already provided! Please don't just tell me the answers bc I know them already. Help me with my own question. I get everything else in this problem other than the third option: Introduce the mutant human HD allele as a transgene into the mouse genome with transgene integration anywhere in the mouse genome. Why is the first question (left) okay with introducing mutant human HD allele and the second question (right) is not? I heard that introducing allele without using CRISPR-Cas9 is very rare and difficult. If so, how does it work in the first problem (Hungtinton's chorea)?| 四 ii D YouTube W Maps 6 viewbook-for-sim. Aid & Awards - Of.. O 2022-23_UAB_pa. W Student Z - McMa. Transfer your Gma. M MarkBook CON. (a) What type of mutation would be least harmful to an organism: silent, missense, or nonsense? Explain your answer. (b) What is the difference between gene mutations and chromosomal mutations? Paragraph В I. + v ... Lato (Recom... 19px... v 民 Add a File Record Audio Record Video MacBook Pro
- What phenotypes do you think a homozygous tra1hsn animal with a loss of function Egl-1 mutation would have.I need help answering the following question from the following article https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2762880/ Science and Society: In 1966, Stanley Gartler presented his findings at an international conference- 18 of the most commonly used cell lines all contained the same genetic marker, G6PD-A. This gene allele is found almost exclusively in African Americans. This was a problem because a large number of these cell lines, excluding HeLa cells, were established from Caucasian individuals. He suggested that these lines were in fact contaminated with HeLa cells, which proliferate at extreme rates and were used in labs all over the world. What would you expect was the response of those scientists using the “contaminated” cell lines? Do you think this marker is enough to establish this contamination?THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the ß chain of hemoglobin. The ß chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. mone formed DNA Template Strand: 3'CACGTGGACTGAGGACTCCTC5' 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 4. What amino acids will this mRNA code for? 3. What mRNA will be formed from the template strand of DNA? 5. If the 17th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 67
- Associated SNPs outside of gene no effect on protein production or function. T G Associated SNPs within gene no effect on protein production or function Regulatory sequences A Coding region с T Noncoding SNP: changes amount of protein produced www.Biolnteractive.org Causative SNPs within gene Unassociated SNP far from gene on same chromosome or different chromosome Protein Coding SNP: changes amino acid sequence b. Which types of SNPs might be identified in a GWAS? 4. Consider the different types of SNPs shown in Figure 3: associated, unassociated, and causative (including both noncoding and coding). a. Which types of SNPs affect protein production or function for the gene of interest? Figure 3. A diagram showing various ways in which a SNP could be associated with a certain gene and its trait. GWAS in the News Read the following news release, which describes a GWAS study with dogs. Note that a dog's coat refers to its fur or hair. Variants in Three Genes Account for Most Dog Coat…D Question 23 What is predictive DNA Phenotyping? O a method using known phenotypes to predict a suspect's DNA profile an STR profile a method using DNA sequence information to predict identifying phenotypes O a genotypic profile based on combined mitochondrial and Y-chromosome STR genotypes Question 24Word AaBbCcI AaBb CcD AaB AaBbCсI AaBbCcL 4 1 Normal Subtitle Title 1 No Spaci... Subtle Em..... Create and Share Adobe PDF Styles Adobe Acro P 1 1 2 4 A 3. A AL T L 4 E 5 E Question 6: The largest chromosome in Mischievous gremlinus has a length of 9 x 107 base pairs. The rate of DNA synthesis is 3,000 bp per minute at each replication fork. a. How long does it take to replicate the entire chromosome from a single origin of replication located exactly in the middle of the chromosome? Assume no pauses. I b. Experiments performed by Professor Trink reveal that it takes only 20 minutes for a growing cell to replicate this chromosome. What is the minimum number of replicons present on the chromosome? Florian Fischer Find v Replace Select Editing 153 23
- QUESTION 3. The pedigree below traces Menkes disease (MNK), an X-linked recessive disorder that affects copper levels in the body, leading to copper deficiency. MNK is caused by mutations in the copper transport gene ATP7A (abbreviated as A in the questions below), which is responsible for making a protein that is important for regulating the copper levels in the body. 1 3 4 II A. What is the genotype of individual Il-4? X^X-. XAY. e B. What type of gamete(s) and in what proportion(s) can individual II-1 make? a All Xª. b All XA. % XA, % X2. % X, ½ Y. % XA, % Y. eJekyll-Hyde Afflicted Spider Curse Afflicted Jekyll-Hyde/Spider Curse I O Human 1 II 1 III 4. Jekyll-Hyde disease is characterized by transformation into an unfeeling, aggressive, alter ego at night. While the "Spider Curse" is a disease that causes affected individuals to grow extra arms and extra eyes during a full moon. The genes responsible for these diseases sort independently and both traits run in one family. Based on the above pedigree answer the following questions: What is the mode of inheritance for Jekyll-Hyde disease? (Hint: look at individuals III-1 & III-3) O a. Autosomal Dominant O b. Autosomal Recessive O c. X-Linked Dominant O d. X-linked Recessive What evidence supports your hypothesis? Give at least 2 pieces of information from the pedigree that support your answer to 3a. Answer: 2. 3. 2. 2.Moving to another question will save this response. Quèstion 4 What determines the code, or information, of a DNA molecule? O 1. the shape (structure) of the nitrogen bases O 2. the order (sequence) of the nitrogen bases 3. the color of the nitrogen bases O 4. the frequency (number) of nitrogen bases 5. All of these A Moving to another question will save this response. AR SONY 山