Which of the following are needed for successful DNA replication? Selected answer will be automatically saved. For keyboard navigation, press up/down arrow keys to select an answer. a b с d Gyrase. RNA Primase. Helicase. All of the above

Q: List and explain three reasons why DNA replication is very accurate.  Is this true for both…

A: Introduction: Replication is a process by which each strand of the dsDNA is duplicated into a…

Q: A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment,…

A: While deciphering a sequencing gel, we know that it depends on terminating the reaction at 3' end…

Q: Fill in the blank spaces below with the most appropriate terms. The word bank is not provided. DNA…

A: During cell division DNA makes a copy of itself and this process is called DNA replication. In this…

Q: Which of the following statements regarding the fidelity of DNA replication is true? OI. DNA…

A: DNA replication is the process of producing more copies of DNA. DNA replication occurs at both the…

Q: Which of the following statements regarding Nucleotide Excision Repair (NER) and Base Excision…

A: DNA can be damaged through many processes such as exposure to radiation or mutations. These damaged…

Q: Which would need to occur to replicate DNA? (select all that apply)  Group of answer choices the…

A: DNA replication is the process by which the double-stranded DNA molecules replicate to produce…

Q: Compare to the original double helix, evaluate the copies made during three attempts of DNA…

A: DNA has a double stranded structure. During DNA replication, the DNA double helix unwinds & each…

Q: What is the function of DNA primase in DNA replication? O to insert new bases during elongation,…

A: DNA is a molecule made up of a chain of identical five-carbon sugars (polymers) that are linked…

Q: Which enzymes are involved in DNA replications? There are multiple answers. Helicase DNA polymerase…

A: DNA replication is the mechanism by which the eukaryotes and the prokaryotic DNA generates a copy of…

Q: The enzymatic activity of prokaryotic DNA polymerases is faster than that of eukaryotic DNA…

A: DNA replication is the synthesis of a new DNA strand. This synthesis of a new DNA strand takes place…

Q: Which of the following is matched correctly? DNA helicase: unwinds DNA prior to transcription DNA…

A: The study of molecular biology, which includes biomolecular synthesis, modification, processes, and…

Q: In the boxes below, complete the Original DNA, DNA Copy and/or RNA

A: DNA replication is the process in which one of the strands of DNA is used as a template and a new…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand:  5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: Show the replication strands in each of these bubbles (note they have different DNA orientations).…

A: DNA Replication  Replication of DNA is a process of duplication of DNA, carried out by DNA…

Q: The image below shows the replication bubble of a piece of DNA in the process of replication.…

A: DNA replication is the process to make copies of DNA. The new DNA strands are always synthesized…

Q: Which of the following is correct about the function of DNA Ligase? O DNA ligase is used on the…

A: In the process of replication ie, copying the strand of DNA. There are several enzymes needed to…

Q: DNA topoisomerase makes single or double-stranded cuts in DNA to induce or relax supercoiling or…

A: Different enzymes are involved in the process of DNA replication. Topoisomerases are one such class…

Q: What is the function of DNA helicase in DNA replication? to create an RNA primer to initiate DNA…

A: DNA polymerase plays a key role in new DNA synthesis.  In eukaryotes, DNA polymerases can be…

Q: Which of the following statements are true regarding the properties of DNA and RNA polymerase.…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: This diagram shows the functions of different enzymes during DNA replication. Which label would…

A: Cells are the basic unit of life and life originated from nucleic acid according to several theories…

Q: Match the proteins with their function in DNA replication. unwinds DNA at replication fork forms…

A: The production or synthesis of new DNA from old DNA strands is known as DNA replication. It occurs…

Q: During DNA replication, DNA polymerase adds nucleotides to the: 3' end of the newly synthesized…

A: Answer: The correct answer is option (2) 3' end of the newly synthesized strand as it moves towards…

Q: A piece of DNA fragment is sequenced. cloned DNA fragment, and set up a series of four dideoxy…

A: Gel Electrophoresis is the process of separating DNA fragments based on their size using…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.