When the ribosome reaches a nonsense codon, which of the following occurs?     a methionine is incorporated     the polypeptide is released     a peptide bond forms     the A site binds to a charged tRNA

Q: Which of the following is involved in the termination of translation in bacteria?   RF1 and RF2 A…

A: Stop codons are not read by tRNAs. Hence, incorrect. Ef Tu and Ef G are involved in elongation of…

Q: A tRNA has the anti-codon sequence 5' UAC 3. What amino acid do you expect to be attached to this…

A: Translation is a process in which sequence of nucleotides in mRNA is translated into the sequence of…

Q: What does the A site on the ribosome do?     What does the P site on the ribosome do?…

A: The ribosome is a complex molecule made up of ribosomal RNA molecules and proteins that functions as…

Q: EF-tu     binds to the 3'end of charged tRNAs     can only bind a charged tRNA when it is…

A:

Q: codons are part of the molecular structure of

A:

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: The "factory" itself, made of two [Choose] subunits [Choose] FRNA The site from which the growing…

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Q: Which of the following is a true statement concerning codons  A codon Will be read by RNA…

A:

Q: ICH one is the next tRNA that will arrive to the "A" site of this ribosome? 000000 Gly Arg Glu Pro…

A: The A site is where the next tRNA molecule carrying an amino acid binds to the mRNA. The tRNA…

Q: Choose the answer that has these events of protein synthesis in the proper sequence. (Note some…

A: The steps of Protein synthesis are collectively  called translation it involves forming proteins…

Q: Which of the following is least likely following translation termination? The polypeptide is…

A: Introduction: Translation of termination is process in  which the genetic code is  within a…

Q: After the complete ribosome is assembled, what is the first amino-acyl tRNA to enter the ribosome's…

A: In the process of protein synthesis, ribosomes play a crucial role by facilitating the translation…

Q: Which of the following is NOT true of transfer RNA (tRNA)? Each individual molecule of tRNA can…

A: Introduction  tRNA (Transfer RNA) is a type of RNA molecule that plays a crucial role in the process…

Q: Which of the following base pairings are allowed between an anticodon and the 3' base of a codon,…

A: According to wobble hypothesis, the third nucleotide of anticodon is a wobble and can base pair with…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: If you were able to watch a ribosome move along a mRNA by one codon, which of the following would…

A: Translation: The process through which RNA codes for specific proteins is known as translation. It…

Q: The genetic code is made of 3 RNA nucleotides read 3-->5' 3 RNA nucleotides read 5'-->3' 3 DNA…

A: In molecular biology, the central dogma controls the process of transcription in which DNA is…

Q: During protein synthesis, which step does NOT require energy? dissociation of the 70S ribosome after…

A: The process of gene expression involves two steps: transcription and translation. Translation is the…

Q: Which of the following is located at the C-terminus of a newly synthesized eukaryotic proteins?…

A: Initiation of translation occurs when the small ribosomal subunit binds with initiation factors and…

Q: Amino acids are carried to the ribosome attached to molecules called initiation factors

A: For each amino acid, a group of organic molecules consisting of a basic amino group, an acidic…

Q: 1)Which of these molecules is responsible for bringing the correct amino acid to the ribosome? RNA…

A: Translation is the process by which proteins are synthesized using ribosomes. It takes place in the…

Q: Which of the following is the first step of translation in a eukaryotic cell? a RNA containing…

A: Translation is the process of protein synthesis which is done by ribosomes.

Q: A- Anticodon

A: Translation: It is the process of synthesis of protein from the mRNA inside the ribosome. The t-RNA…

Q: Name all components you would find in a fully assembled ribosome during elongation of protein…

A: Protein synthesis or translation consists of three stages - initiation, elongation and termination.…

Q: A point mutation that changes a codon specifying an amino acid into a stop codon is called a

A: Point mutations are those which substitutes one nucleotide (within) a codon into another. Due to…

Q: Once the large ribosomal subunit joins     the charged tRNA is at the A site     the charged tRNA…

A:

Q: Use the codon sequence  to translate the following mRNA sequence (start with the start codon - AUG -…

A: Genetic codons are sequences of three nucleotides (nitrogenous bases) found in messenger RNA (mRNA)…

Q: The P site of a ribosome does which of the following?     It holds the tRNA carrying the growing…

A: The p-site is known as the peptidyl site and the A-site is the acceptor site which binds to the…

Q: Below is a diagram of charged TRNAS in the active site of the ribosome during translation of the…

A: Each aminoacyl-tRNA synthetase's active site functions as a "lock and key" for an associated tRNA…

Q: The synthesis of a protein requires that the amino acids that constitute the growing polypeptide…

A: In the intricate dance of cellular processes, protein synthesis takes center stage, orchestrating…

Q: Which of the following statements best explains why there are many more codons than there are amino…

A: The genetic codon is the sequence of three successive nucleotides present in the mRNA that codes…

Q: In the normal course of events within protein synthesis, which of the following is part of, or cal…

A: The tRNA molecule has a distinctive folded structure with three hairpin loops that form the shape of…

Q: What type of the mRNA is recognized as a first step of translation initiation in eukaryotes? a TaTA…

A: Translation is the process that results in protein synthesis. It takes place in the cytoplasm. This…

Q: The 3 sites that bind tRNAs on a ribosome are on the A, P and E sites. How many sites can tRNA(s) be…

A: Translation is the formation of protein from mRNA. It occurs in cytoplasm of cell.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.