In the normal course of events within protein synthesis, which of the following is part of, or cal directly attach to, a tRNA molecule? (mark all three correct answers) O an adenine tail MRNA polymerase an amino acid an anti-codon O a DNA triplet а codon ribosome O a transcription factor

In the normal course of events within protein synthesis, which of the following is part of, or cal directly attach to, a tRNA molecule? (mark all three correct answers) O an adenine tail MRNA polymerase an amino acid an anti-codon O a DNA triplet а codon ribosome O a transcription factor

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

The synthesis of a protein requires that the amino acids that constitute the growing polypeptide chain be covalently linked to the amino acid attached to the tRNA at the aminoacyl site of the ribosome. Which of the following catalyses this reaction? Options: the aminoacyl tRNA synthetase eEF2 eEF1-GTP a large ribosomal RNA the initiator tRNA met
Describe the charging process of a tRNA.
Given the mRNA sequence ,5’-AUGUACAAGGUCGGAUGA-3’ which of the following amino acid sequence would result from translation? Tyr-met-val-lys-gly Met-val-lys-tyr-gly Met-tyr-lys-val-gly Ser-arg-leu-glu-his-val Gly-met-val-lys-tyr
Which of the following events would NOT result in ribosomes stalling on an MRNA during translation? The MRNA in a given region is very highly folded, and the ribosome stalls because the RNA structure blocks its movement. O The correct tRNA is scarce because it is not transcribed very much in the prevailing conditions. The ribosome stalls while waiting for one of the scarce tRNAS to diffuse into the A site. O the release tactor enters the A site, decodes a stop codon and transfers an oxxYgen from water to the carboxyl group of the peptidyl-tRNA in the P site, causing stalling O Starvation for amino acids will reduce the amount of amino-acylated (charged) tRNA the ribosome will stall while waiting for a charged tRNA to enter the A site to decode the next codon
The primary structure of a protein is ultimately determined by an MRNA molecule an FRNA molecule O a polymerase enzyme O a DNA gene
Construct a polypeptide chain by translating the given red strand of the mRNA segment. AUG-ACA-GUG-UCA-UAC-AAG-CCU-CAU-GCC-GUC-AUA-CUU-GGG-UGU-GAC-CUA-AUA
Describe the key structural features of a tRNA molecule.
Describe how tRNA is charged with an amino acid.
An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that would be translated from this mRNA.
The attachment of an amino acid to a tRNA is called
Describe two special reaction sites on the tRNA
For each of the following, identify the type of RNA involved (mRNA, rRNA, or tRNA). a. Transports the correct amino acid to the ribosome, using the information encoded in the mRNA. b. Is a major component of ribosomes. c. Speciﬁes the order of amino acids in a protein, using a series of three-base codons, where different amino acids are speciﬁed by particular codons. d. Contains a three-base anticodon that pairs with a complementary codon revealed in the mRNA. e. Assists in making the bonds that link amino acids together to make a protein.