In the normal course of events within protein synthesis, which of the following is part of, or cal directly attach to, a tRNA molecule? (mark all three correct answers) O an adenine tail MRNA polymerase an amino acid an anti-codon O a DNA triplet а codon ribosome O a transcription factor
Q: Which of the following is a feature of tRNA that is important for its function in translation? O The…
A: Ans : Most important feature of tRNA that is important for its function in translation is - the…
Q: Describe the events of protein translation that occur on the surface of a ribosome.
A: The central dogma of life involves transcription of the DNA into mRNA during which the genetic code…
Q: Shown below is a codon in an mRNA. What is the correct sequence of the tRNA anticodon that…
A: The given messenger ribonucleic acid (mRNA) codon 5’-CAG-3’ codes for the amino acid glutamine.…
Q: During translation, the codon in mRNA is actually “read” by a. the A site in the ribosome. b.…
A: The translation is a process of conversion of mRNA into polypeptides and then into proteins. It…
Q: According to the adaptor hypothesis, is each the following statementstrue or false?A. The sequence…
A: Introduction: According to the adaptor hypothesis, the RNA molecules would be connectors that could…
Q: The mRNA sequence AUG CAC AGU codes for the first three amino acids of a particular protein. Which…
A: The mRNA synthesized after transcription process undergoes translation to synthesize proteins. The…
Q: According to the adaptor hypothesis, is each of the following statements true or false? A. The…
A: Codons are the triplet nucleotide sequences either of RNA or DNA, which helps in binding specific…
Q: If an mRNA codon reads UAC, its complementary anticodon will bea. TUC.b. ATG.c. AUG.d. CAG
A: During translation the ribosome traverses over the mRNA in order to produce a peptide chain with the…
Q: Spliceosomes play central roles in .. a) removal of exons from pre-mRNA b) removal of introns from…
A: The mRNA transcribed from the DNA is heterogeneous mRNa or pre mRna which is not the final product.…
Q: Which of the following is NOT a correct pairing of the RNA type and its job O A. TRNA - in…
A: Introduction:- RNA (ribonucleic acid), complex compound of high molecular weight that functions in…
Q: In the chain elongation of proteins, the new aminoacyl-tRNA bonds to? a.A site b.E site c.G site…
A: Translation is process by which the cells produce protein from the information provided by the DNA.…
Q: If the codon in the mRNA is 5' AUG', then the anticodon of the initiator tRNA is 5' CAT3' O 3' UAC5'…
A: CODON- It is a unit of three nucleotides that forms a genetic code in a DNA/RNA.
Q: A ribosome binds to the following mRNA at the site indicatedby the dark box. At which codon will…
A: The mRNA strands obtained after the transcription of the antisense DNA strand (also known as the…
Q: What is the anti-codon in tRNA that corresponds to the codon pGpCpA in MRNA? А. рТрGpC В. рСpGpT С.…
A: During replication and transcription a nucleic acid was copied from another nucleic acid. Hence this…
Q: A mutation to a tRNA with the anticodon of AGG changes the amino acid bound to the TRNA from serine…
A: Mutation refers to alterations in the DNA sequence. These alterations can either be produced due to…
Q: When MRNAS are edited to become mature mRNA, the nonsense regions that are removed are called and…
A: Ribonucleic acid (RNA) is a significant organic macromolecule that is available in all natural…
Q: Which of the following sentences is INCORRECT: The aminoacyl TRNA synthetase charge O the TRNA…
A: tRNA is a type of RNA molecule that helps decode a messenger RNA sequence into proteins. tRNA has…
Q: Consider the wobble rules listed in Table 15.2. An MRNA has the stop codon 5' UAA 3'. What TRNA…
A: Codon is a triplet of nucleotide base pairs.
Q: Which term describes each of these steps or substeps in the translation process? The ribosome shifts…
A:
Q: An MRNA has the codon 5' GUA 3'. What tRNA anticodon will bind to it ? A) 5' CTA 31 B) 5' ATC 3' C)…
A: DNA replication is the process of formation of identical copies of DNA. It occurs in the nucleus of…
Q: How would protein synthesis be affected ifa single codon could specify the incorporation of more…
A: Ambiguous codon is the codon that codes for more than one amino acid.
Q: The genetic code derives its specificity through what interactions? O hydrogen bonds that maintain…
A: Genetic code: - Triplet - 64 different codons - 61 sense codons and 3 stop codons - Nearly universal…
Q: During translation, the _________ of tRNA binds to the __________ of mRNA and _____________is added…
A: Introduction: The process of encoding the mRNA sequences transcribed from DNA is called translation.
Q: Which of the following is true in translation? Codons on MRNA match to identical anticodons on tRNA…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: In a tRNA molecule, the anticodon loop refers to the site where the tRNA willI bind the mRNA. the…
A: Translation is the process in which proteins are synthesized by ribosomes.Translation occurs after…
Q: When a codon in an mRNA with the sequence 5′-UAA-3′ enters the A site of a ribosome, it is not…
A: The process of reading the mRNA transcript to form proteins by joining the different amino acids…
Q: An mRNA has the codon 5’ GUA 3’. What tRNA anticodon will bind to it?
A: The synthesis of polypeptide chains from mRNA is aided by translation. The ribosome (both ribosomal…
Q: In which of the ribosomal sites, the A site, P site, and/or E site, could the following be found? A.…
A: Ribosomes are small and round bodies that are either found floating freely in the cytoplasm, or…
Q: Which of the following is unique to eukaryotic mRNA synthesis? O Coupled transcription-translation O…
A: The correct option is Removal of Introns. Explanation: Before it can be translated, eukaryotic…
Q: A- Anticodon
A: Translation: It is the process of synthesis of protein from the mRNA inside the ribosome. The t-RNA…
Q: Sequence the following steps in protein synthesis from first to last. Write only the numbers (1-6)…
A: Protein synthesis refers to the process of formation of protein molecules by the cells of an…
Q: Indicate the phase of protein synthesis during which each of the following processes occurs: a. A…
A: The process of synthesis of proteins is called translation. Translation occurs in mainly three…
Q: Which of the following is true for the tRNA of eukaryote cells? tRNA is a) made of DNA and protein,…
A: In nucleus the tRNAs are prepared and released to the cytoplasm. In there they attached to amino…
Q: Put the events of translation in order. A. Ribosome reads the start codon and initites…
A: Translation is the process of peptide synthesis in any living organism. It involves the ribosome…
Q: Below is a diagram of charged TRNAS in the active site of the ribosome during translation of the…
A: Each aminoacyl-tRNA synthetase's active site functions as a "lock and key" for an associated tRNA…
Q: During the initiation of translation, the ribosome assembles on an mRNA strand with the start codon…
A: The process of polymerisation of amino acids from a polypeptide is known as translation. The…
Q: The primary structure of a protein is ultimately determined by an MRNA molecule an FRNA molecule O a…
A: The primary structure simply means the sequence of amino acids in a polypeptide chain. By the…
Q: Which of the following types of RNA carries the genetic information from DNA in the nucleus to the…
A: Since there are multiple questions in this particular question, I will answer the first one for you.…
Q: When translation begins, the first amino acid heads to the small subunit of the ribosome. What…
A: The translation is a process in molecular biology whereby the cell reads information from messenger…
Q: Which of the following is not true of a codon?(A) It may code for the same amino acid as another…
A: The genetic code involves the set of rules determining the conversion of nucleotide sequence into a…
Q: Which type of biological molocule is being made during this process? Incoming tRNA Bound NA to Amino…
A: The figure is showing the process of translation. Translation is the process of formation of a…
Q: The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA…
A: Hello, thank you for your question. The second part of the question seems to be incomplete,…
Q: If the codon for Histidine is 5' CAU 3' in an MRNA molecule, the anticodon on the TRNA is: UAC ATG…
A: In every group of messenger ribonucleic acid (mRNA), there are three bases. A codon is also there…
Q: The process of gene transcription begins with the joining of rRNA with various ribosomal proteins.…
A: The method of copying a part of DNA into RNA is referred to as transcription. DNA fragments…
Q: The relaxation of base-paring rules between the TRNA and mRNA is termed as Answer:
A: Introduction: Ribonucleic acid or RNA is the type of nucleic acid that is mainly present in the…
Q: Which of the following statements about the splicesome is correct? The spliceosome controls the…
A: A spliceosome may be a large ribonucleoprotein (RNP) advanced found primarily inside the nucleus of…
Q: Below are the general steps of protein synthesis. What is the correct sequence of protein synthesis?…
A: The process of synthesis of proteins is called translation. Proteins are synthesised in a cell in…
Q: Describe the processes of transcription and translation from DNA to polypeptide chain
A: Polypeptides are amino acid chains joined together by peptide bonds. Amino terminal or N terminal…
Q: An amino acid sequence reads:N—Met-Gln-Leu-Arg-Cys—C Write out one possible mRNA sequences with a…
A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…
Step by step
Solved in 2 steps
- Identify the features of tRNA that are important in decoding genetic information and converting it into protein language.A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
- If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. fiveBriefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNAA gene contains the sequence GGCTAAC. What is the sequence of the MRNA transcribed from this strand of DNA? CCGATTG CCGAUUG GGCTAAC GGCUAAC
- he sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…Order of bases in DNA Order of bases in MRNA (codon) AUC Order of bases in tRNA (anticodon) UAG TAG Amino acid coded into proteins CAT CAU GUC CCA ATG Methionine (Met) Valline (Val) GUU, GUC, GUA, GUG ACU ACA UGU AAA AAA GAA CuU Procedure: Refer to the Genetic Code Table below to identify the right amino acid coded. To determine the order of bases in the first column (UNA), second column (codon) and the third column Is the anticodon. Consider the complementary base pair, in DNA and in RNA To identify the amino acid, took at the bases in the MRNA codon, example AUG using the Genetic Code Table. Loo: for the first letter of the MRNA codon on the left side of the genstis code table (A), the second letter of the MRNA on the second letter column (U), and the third letter on the right-side column (G). AUG codes for the amino acid -methionine. Do the same with the other codons in the chart. Genetic Code Table and posticn of codon Cystelne Cysteine UAU TyrY UAC Tyr Y Tyrosine USA UAG CAU His H…A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
- If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- GFor each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino AcidIf DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G
