Using a computer algorithm that searches for sequence similarities in other organisms, you discover that hexose kinase is a highly conserved gene that is expressed by many species, both prokaryotic and eukaryotic. The most closely related prokaryotic homolog of hexose kinase has a protein sequence in which 90% of the amino acids are identical to those of the human version of the gene. To learn more about their similarity at the DNA level, you obtain segments of the genomic DNA coding for the hexose kinase gene in both humans and this prokaryotic species. After combining both DNA samples, you heat them to denature the DNA strands and then allow them to cool and reanneal. Finally, you examine the DNA hybrids you obtain under the electron microscope. Practice Question 3 A) Your analysis reveals that there are three different DNA hybrids in this sample, these can be seen below. You reason that one must belong to the prokaryotic species, one to the humans and the third arose when one strand from each species base paired. Identify the origin of the DNA in each one of the observed structures by circling the correct answers below

Using a computer algorithm that searches for sequence similarities in other organisms, you discover that hexose kinase is a highly conserved gene that is expressed by many species, both prokaryotic and eukaryotic. The most closely related prokaryotic homolog of hexose kinase has a protein sequence in which 90% of the amino acids are identical to those of the human version of the gene. To learn more about their similarity at the DNA level, you obtain segments of the genomic DNA coding for the hexose kinase gene in both humans and this prokaryotic species. After combining both DNA samples, you heat them to denature the DNA strands and then allow them to cool and reanneal. Finally, you examine the DNA hybrids you obtain under the electron microscope. Practice Question 3 A) Your analysis reveals that there are three different DNA hybrids in this sample, these can be seen below. You reason that one must belong to the prokaryotic species, one to the humans and the third arose when one strand from each species base paired. Identify the origin of the DNA in each one of the observed structures by circling the correct answers below

Name: Using a computer algorithm that searches for sequence similarities in
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Using a computer algorithm that searches for sequence similarities in other organisms, you discoverthat hexose kinase is a highly conserved gene that is expressed by many species, both prokaryoticand eukaryotic. The most closely related prokaryotic

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

Gene editing is also used to explore the structure and function ofproteins. For example, changes can be made to the coding sequenceof a gene to determine how alterations in the amino acid sequenceaffect the function of a protein. Let’s suppose that you areinterested in the functional importance of a particular glutamicacid (an amino acid) within a protein you are studying. By geneediting, you make mutant proteins in which the glutamic acidcodon has been changed to other codons. You then test the encodedmutant proteins for functionality. The results are as follows: FunctionalityNormal protein 100%Mutant proteins containingTyrosine 5%Phenylalanine 3%Aspartic acid 94%Glycine 4%From these results, what would you conclude about the…
Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
Since it was deciphered four decades ago, somehave claimed that the genetic code must be a frozen acci-dent, while others have argued that it was shaped by nat-ural selection. A striking feature of the genetic code is itsinherent resistance to the effects of mutation. For example,a change in the third position of a codon often specifies thesame amino acid or one with similar chemical properties.The natural code resists mutation more effectively (is lesssusceptible to error) than most other possible versions, asillustrated in Figure Q1–1. Only one in a million comput-er-generated “random” codes is more error-resistant thanthe natural genetic code. Does the extraordinary mutationresistance of the genetic code argue in favor of its origin asa frozen accident or as a result of natural selection? Explainyour reasoning.
Duchenne muscular dystrophy is caused by a mutation in a gene that comprises 2.5 million base pairs and specifies a protein called dystrophin. However, less than 1% of the gene actually encodes the amino acids in the dystrophin protein. On the basis of what you now know about gene structure and RNA processing in eukaryotic cells, provide a possible explanation for the large size of the dystrophin gene.
Trinucleotide repeat expansions (TNREs) are associated with severaldifferent human inherited diseases. Certain types of TNREsproduce a long stretch of the amino acid glutamine within theencoded protein. When a TNRE exerts its detrimental effect byproducing a glutamine stretch, are the following statements true orfalse?A. The TNRE is within the coding sequence of the gene.B. The TNRE prevents RNA polymerase from transcribing thegene properly.C. The trinucleotide sequence is CAG.D. The trinucleotide sequence is CCG.
You are studying a eukaryotic protein PKK in the lab. You fuse the DNA encoding GFP (green fluorescent protein) to the C terminus of the PKK gene. You also create the following GFP-PKK variants -GFP Wild- type: N- Signal sequence Transmembrane domain Kinase domain Variant 1: N- GFP Transmembrane domain Kinase domain Variant 2: N- -GFP Signal sequence Transmembrane domain Variant 3: N- -GFP Signal sequence Kinase domain Variant 4: N- -GFP Kinase domain If you examine wild-type PKK trafficking in a eukaryotic cell, which of the following are true? Select all that apply This fusion protein will be trafficked to the nucleus This fusion protein is a cell membrane protein This fusion protein will be trafficked to the Endoplasmic Reticulum This fusion protein is a nuclear protein
Suppose that the diagram below represents the genomic organization of an enzyme involved in eye pigment production in mice. Within the gene are four exons. Biochemical analysis has revealed that the active site of the enzyme is located in the C terminus of the protein. -The nucleotide length of each exon and intron is shown. -The dinucleotide sequence GT represents the 5’ splice site and the dinucleotide sequence AG represents the 3’ splice site. Both the 5’ and the 3’ splice sites must be present for splicing to occur. Assume that the first and second stop codons are located immediately after the first and second 5’ splice sites, respectively; the third and fourth stop codons are located near the 3’ end of exons 3 and 4, respectively; all these stop codons are in the correct reading frame. a) draw what the processed mRNA will look like. Include the start codon on the mRNA and label the approximate locations of the 5’ UTR and 3’ UTR on the transcript. (You do not need to add the 5’ CAP…
Within living cells, many different proteins play importantfunctional roles by binding to DNA. Some proteins bind to DNA butnot in a sequence-specific manner. For example, histones are proteinsimportant in the formation of chromosome structure. The positivelycharged histone proteins bind to the negatively charged phosphategroups in DNA. In addition, several other proteins interact with DNAbut do not require a specific nucleotide sequence to carry out theirfunction. For example, DNA polymerase, which catalyzes thesynthesis of new DNA strands, does not bind to DNA in a sequencedependent manner. By comparison, many other proteins do interact with nucleic acids in a sequence-dependent fashion. This means that a specific sequence of bases can provide a structure that isrecognized by a particular protein.Someexamples include transcription factors that affect the rate oftranscription and proteins that bind to origins of replication inbacteria.What information do you know based onthe question…
Within living cells, many different proteins play importantfunctional roles by binding to DNA. Some proteins bind to DNA butnot in a sequence-specific manner. For example, histones are proteinsimportant in the formation of chromosome structure. The positivelycharged histone proteins bind to the negatively charged phosphategroups in DNA. In addition, several other proteins interact with DNAbut do not require a specific nucleotide sequence to carry out theirfunction. For example, DNA polymerase, which catalyzes thesynthesis of new DNA strands, does not bind to DNA in a sequencedependentmanner. By comparison, many other proteins do interactwith nucleic acids in a sequence-dependent fashion. This means that a specific sequence of bases can provide a structure that isrecognized by a particular protein.Someexamples include transcription factors that affect the rate oftranscription and proteins that bind to origins of replication inbacteria.What topic in genetics does this question address?
Within living cells, many different proteins play importantfunctional roles by binding to DNA. Some proteins bind to DNA butnot in a sequence-specific manner. For example, histones are proteinsimportant in the formation of chromosome structure. The positivelycharged histone proteins bind to the negatively charged phosphategroups in DNA. In addition, several other proteins interact with DNAbut do not require a specific nucleotide sequence to carry out theirfunction. For example, DNA polymerase, which catalyzes thesynthesis of new DNA strands, does not bind to DNA in a sequencedependentmanner. By comparison, many other proteins do interactwith nucleic acids in a sequence-dependent fashion. This means thata specific sequence of bases can provide a structure that isrecognized by a particular protein.Someexamples include transcription factors that affect the rate oftranscription and proteins that bind to origins of replication inbacteria. With regard to the three-dimensional structure of…
You are studying a eukaryotic protein PKK in the lab. You fuse the DNA encoding GFP (green fluorescent protein) to the C terminus of the PKK gene. You also create the following GFP-PKK variants Wild- type: N- -GFP Signal sequence Transmembrane domain Kinase domain Variant 1: N- -GFP Transmembrane domain Kinase domain Variant 2: N- GFP Signal sequence Transmembrane domain Variant 3: N- GFP Signal sequence Kinase domain Variant 4: -GFP Kinase domain If you examine PKK variant 4 trafficking in a eukaryotic cell, which of the following are true? Select all that apply This fusion protein will be made as a cytosolic protein This fusion protein will not function like the wild-type protein This fusion protein will traffic to the cell membrane This fusion protein will not traffic to the cell membrane