An enzyme isolated from rat heart has 261 amino acid residues and is encoded by a gene with 1305 bp. What is the relationship between the number of amino acid residues in the enzyme and the number of nucleotide pairs i its gene? The 1305 bp gene encodes the 261 amino acid enzyme and another enzyme that is 174 bp. The 261 amino acids are encoded within introns spanning 783 bp of the gene's transcript. The entire 1305 bp gene codes for amino acids in the enzyme. Five nucleotides code for a single amino acid. The 261 amino acids are encoded by 783 bp. The remaining 522 bp in the sequence are not translated.

An enzyme isolated from rat heart has 261 amino acid residues and is encoded by a gene with 1305 bp. What is the relationship between the number of amino acid residues in the enzyme and the number of nucleotide pairs i its gene? The 1305 bp gene encodes the 261 amino acid enzyme and another enzyme that is 174 bp. The 261 amino acids are encoded within introns spanning 783 bp of the gene's transcript. The entire 1305 bp gene codes for amino acids in the enzyme. Five nucleotides code for a single amino acid. The 261 amino acids are encoded by 783 bp. The remaining 522 bp in the sequence are not translated.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
An enzyme isolated from rat liver has 193 amino acids and is and encoded by a 1440 base pair long gene. What is the connection between the amino acid number of the enzyme and the number of nucleotide pairs in its gene. Explain clearly please
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
You isolate an E. coli strain in which a mutation in the gene encoding the tRNAAla synthetase enzyme causes it to charge both tRNAAla and tRNACyS TRNAS with Alanine (Ala). You sequence the N-terminus of a protein, which normally has the sequence: Met-Cys-Ala-Thr-Tyr-- Which sequence(s) do you expect to obtain? Select one: O Met-Cys-Ala-Thr-Tyr---- O Met-Cys-Cys-Thr-Tyr---- O Met-Ala-Ala-Thr-Tyr---- O Met-Cys-Ala-Thr-Tyr---- + Met-Cys-Cys-Thr-Tyr---- O Met-Cys-Ala-Thr-Tyr---- + Met-Ala-Ala-Thr-Tyr----
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5' What is the sequence for the partner strand?
For the anticodon sequences 5' IAA and 5' xm^3s^2UAA, considering the DNA sequences of the genes encoding the tRNAs(assuming both tRNAs exist even if that is not true), What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? be sure to indicate polarities.
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
Suppose that there is an unknown protein that underwent Edman sequencing method. From N- terminal determination, a biochemist found out that there are two N-terminal amino acid residues, V and G. What is the original sequence of the protein given the following peptide fragments: after digestion with Chymotrypsin: G-L-S-R-G-M-w V-A-L-F Q-L-Y L-R-V-W G-M-V-E-A-D-I-P K-S-P-E-M-T-W R-M-A-S-E-K-P-G-H after digestion with Trypsin: P-G-H V-W-G-M-V-E-A-D-I-P M-A-S-E-K G-M-W-Q-L-Y-L-R S-P-E-M-T-W-R G-L-S-R V-A-L-F-K after digestion with Cyanogen Bromide: T-W-R-M W-Q-L-Y-L-R-V-W-G-M V-E-A-D-I-P A-S-E-K-P-G-H V-A-L-F-K-S-P-E-M G-L-S-R-G-M
For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also labeled, what are the first 3 nucleotides of the RNA transcribed from this sequence? +1 5.10 +10 3 GAGCGACATAATACGATTAT 5' AUA 3' 5' AAU 3' 5' UAU 3' 5' UUA 3' 5' CUA 3'