Use the codon chart to translate the following MRNA transcript into a protein. Please format your answer in this way Seond letter UGU UGC UAA Stop UGA Stop A UAG Stop UGG Trp G UUU UCU UCC UCA UCG UAU Tyr UAC U Сув C Phe u UUC UUA Leu Ser UUG CCU CUU CỤC CUA CUG CGU CGC CAU His CAC Leu Pro Arg CCA CGA CGG CAA Gin CCG CAG AUU ACU AAU Asn AGU AGC Ser AUC AUA AUG Met ACG lle ACC AAC Thr AAA AAG Lys AGG ACA AGA Arg GCU GCC GCA Ala GUU U GAU Asp GGC GAC GGU GUC Val GUA Gly GAA GGA GGG Glu GUG GCG GAG AUGCCUGGACAUUUUCAAGUAUAA HTML Editor BIUA- A- IEZ 3 x, 三 三 V G+ V D I T 12pt Paragraph First letter Third letter

Q: Consider the following mRNA molecules and the amino acids they code for. The second mRNA molecule is…

A:

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: 1. What is a codon? 2. For eaxh of the following mRNA codons, give the tRNA anticodon and determine…

A: Central dogma of cell comprises of two important processes. They are transcription of DNA into mRNA…

Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…

A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…

Q: please answer the question provided in the picture about the black allele gene asap please

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: RNA-induced gene silencing can be accomplished by cleaving and degrading MRNA encoding for a…

A: The RNA-actuated quieting complex, or RISC, is a multiprotein complex, explicitly a…

Q: This question refers to the MRNA sequence below: 5'-A ACGAAUAUGUUAAUCGUAGCCACCUGGUUCAGCUAAGGUGA-3'…

A: CGU is the correct answer.

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: Second letter of codon U U UC UA UG U CU CC CA CG First letter of AU AC AA AG codon (5'-end) GU GC…

A: The genetic code may be defined as a collection of principles that living cells use to translate…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: In bacteria, RNA transcripts are ready to act as messenger RNAs and get translated into proteins…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the…

A: Introduction Gene expression is the process through which a gene's information is used to create a…

Q: The process of transcription is represented by letter

A: DNA is transcribed into mRNA and mRNA is translated into protein.

Q: 1.How is the genetic code of DNA translated in specific protein molecules

A: Most genes possess information that is needed to produce functional molecules termed proteins. The…

Q: The amino acids listed above that are coded by the mRNA codon

A: Protein synthesis is a major process inside our body .Our body has complex system for protein…

Q: You create a premature stop codon as a result of an induced mutation in the lab. What type of…

A: Premature termination codons (PTCs) are the result of one-nucleotide changes that transform a…

Q: DNAT  A  C         C  G  C      C  C  C        A  T  G      A  T  G       A  A  T       A  C  C…

A: DNA sequencing is the process of determining the sequence of nucleic acids, which are the basic…

Q: Hello , please help me with this question. I am struggling with naming the Amino Acid sequence from…

A: Codon is the triplet of either DNA or RNA nucleotides which codes for a specific amino acid during…

Q: Transcription and Translation Practice Directions: Read each sequence of DNA and transcribe it to…

A:

Q: This question refers to the mRNA sequence below: 5'-AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the…

A: During translation, the mRNA is read in triplets. The incoming tRNA reads the three bases at a time…

Q: Use the genetic decoder provided to assist in answering this question.\ Second letter A UUU UUC Phe…

A: Introduction: The process of polymerization of amino acid to form a polypeptide is called…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Transcribe the following DNA molecule into mRNA.  Make sure to find the start codon to begin your…

A: A start codon initiates the transcription while stop codon terminates the transcription process.

Q: Hello, my question is in the picture below. Thank you in advance!

A: Transcription is the process of converting DNA into m-RNA in the presence of enzyme RNA polymerase.…

Q: 1. What is the sequence of the peptide that would result following translation with a ribosome?…

A: A codon is a three-nucleotide (tri-nucleotide) sequence of DNA or RNA that corresponds to a specific…

Q: 21. The processing events that must occur on the MRNA after it is transcribed, but before it is…

A: In eukaryotes, transcription and translation take place in different cellular compartments:…

Q: Molecule Structure, Function diagram or description TRNA Ribosome MRNA poly-a tail

A: Transcription is the process of synthesis of RNA from DNA, using DNA as a template. It is initiated…

Q: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino…

A: Trancription It refers to the process of copying the genetic sequences of DNA into mRNA. Translation…

Q: The queation on my assignment is select the description of an exon? the answers they give are: 1.…

A: An exon is a coding region of the gene that codes for amino acids. In eukaryotes, genes are made up…

Q: Read the images attached before answering the following question. Explain the meaning of the numbers…

A: Cells, the most fundamental and vital unit in all living things, are made up of them. Cells are in…

Q: Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop…

A: mRNA or messenger RNA contain the genetic codons that must be translated into amino acid chain…

Q: Transcribe the following DNA sequence from HbS. Record your answer to submit for grading. DNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.