The role of the Histidine above the binding site in hemoglobin has been investigated by site-directed mutagenesis. For example, this Histidine has been replaced by the amino acid alanine which has a methyl group (R-CH3) instead of the histidine residue.(a) Would you expect the ability of hemoglobin to bind O2 to be affected by this change? (b) Would you expect the ability of hemoglobin to bind CO (carbon monoxide) to be affected by this change?

The role of the Histidine above the binding site in hemoglobin has been investigated by site-directed mutagenesis. For example, this Histidine has been replaced by the amino acid alanine which has a methyl group (R-CH3) instead of the histidine residue.(a) Would you expect the ability of hemoglobin to bind O2 to be affected by this change? (b) Would you expect the ability of hemoglobin to bind CO (carbon monoxide) to be affected by this change?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Similar questions

If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
Consider the mechanism of the enzyme RNase:  What would happen to the Km (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a lysine? Explain.  What would happen to the Kcat (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a valine? Explain.
The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition sequence for the trp repressor would be expected to occur in the E. coli chromosome? (b) Explain why it is advantageous for the trp repressor to be a dimer that recognizes two adjacent 6-bp sequences.
1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also charged methionine tRNAs with alanine? b)What would happen if an individual was homozygous for mutant alleles of the gene encoding the aminoacyl tRNA synthetase responsible for charging leucine tRNAs?
Breast cancer can be caused by a genetic mutation on the BRCA1 gene changing a methionine to an arginine residue in the transcribed protein. How will this mutation effect this protein? a) Polarity before and after mutation: b) Size of the region before and after the mutation: c) Tertiary interaction you would expect with substrate: d) Name an amino acid that the unaffected protein's methionine could interact:
Two possible point mutations are the substitution of lysine for leucine or the substitution of serine for threonine. Which is likely to be more serious and why?
Below is the DNA base sequence for the normal protein for normal hemoglobin and the base sequence for (abnormal) sickle cell hemoglobin: Normal GGG CTT CTT TTT Sickle GGG CAT CTT TTT A)Transcribe and translate the normal and sickle cell DNA. B)Identify this as a point or frameshift mutation. Explain.
Shown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the effect on the resulting peptide of a deletion of the two nucleotides shown in bold/underline? 5' CTG ACT CCT GAG GAC 3' a) A change from glutamic acid to valine will occur b) The deletion will not result in a change to the polypeptide c) A nonsense mutation will occur d) The polypeptide will be missing one amino acid, but the reading frame will be preserved
A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A)This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B)This will not affect the phenotype because only the second amino acid is different from the original protein. C)This will not affect the phenotype because the protein will be identical to the original protein. D)This will affect the phenotype because all of the amino acids after the first one will be different from the original protein.
Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…
A classic way to isolate thymidylate synthase-negative mutants of bacteria is to treat a growing culture with thymidine and trimethoprim. Most of the cells are killed, and the survivors are greatly enriched in thymidylate synthase-negative mutants. (a) What phenotype would allow you to identify these mutants? (b) What is the biochemical rationale for the selection? (That is, why are the mutants not killed under these conditions?) (c) How would the procedure need to be modified to select mammalian cell mutants defective in thymidylate synthase?
In the: A mutated TBP protein Explain: (a) What is the process affected? (b) What is the Effect on the process? (c) Does it affect prokaryotes, eukaryotes or both?