the RNA world hypothesis and why is it called that
Q: What is an exception to the central dogma of molecular biology? a. Viruses sometimes transfer…
A: The central dogma of molecular biology is that, DNA gets converted into a mRNA by the process of…
Q: 3. Transcribe the following DNA sequences into their corresponding mRNA. (Hint: be sure to pay…
A: Transcription One of the initial steps in gene expression is this procedure. The transport of…
Q: Translation is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…
A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…
Q: Why is RNA necessary to act as a messenger? Why can't the code be taken directly from the DNA? How…
A: Introduction: RNA is a single-stranded molecule that is present in both the nucleus and cytoplasm,…
Q: 5. You imagine that not all life forms (including viruses and aliens) must have double stranded DNA…
A: a.The genome is double stranded RNA. Since, there is no thymine (T) in the genome and there is…
Q: Examine the following coding strand DNA nucleotide sequence,representing the complete gene sequence…
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…
Q: 14. What is an anticodon? a. The three tRNA bases that pair with a specific amino acid. b. The three…
A: What is anticodon? Option b. The three tRNA bases that pair with a specific codon in an mRNA.
Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…
A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…
Q: 10. Which of the following statement(s) is/ are true for the molecule below? (1) It can be found on…
A: Structure of the monosaccharides can be represented using the Fischer projection or Haworth…
Q: 1. Which of the following pairs is mismatched? None of the pairs are mismatched Joseph Lister -…
A: Introduction:- Antibiotics are the drugs or medicines which are used to treat the bacterial…
Q: 1. What principle in biology could explain this statement and discuss why?
A: Biological determinism is the principle that explains the statement " biology points out the…
Q: 5. A mutant strain of Salmonella bacteria carries a mutation of the rho protein t hat has full…
A: Rho factor is involved in termination of transcription in prokaryotes. It binds to termination site.
Q: The flow of genetic information usually takes place from a) RNA to DNA to proteins b) proteins to…
A: In most organisms, genetic information is in the form of deoxy ribonucleic acid (DNA), while in some…
Q: 8. Some antibiotics work by preventing protein synthesis in bacteria by binding to their ribosomes.…
A: Multiple choice answer is given below:
Q: Which of the following best describes why it is possible for the bacteria to read the instructions…
A: The instructions to form a protein is inherent in the template strand of DNA. This template strand…
Q: 1. State the central dogma of molecular biology.
A: The central dogma of molecular biology stands as a foundational principle elucidating the intricate…
Q: 14. Some weed killers, insecticides, and food additives alter the DNA of certain cells. Because of…
A: Because of this effect, these substances are know as 2). Mutagens. Mutagen is an chemical or…
Q: It is known that RNA is a nucleic acid responsible for the synthesis of proteins. However, there is…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: 3. Compare and contrast the contributions of the following two biologists. What would be the effect…
A: Rosalind Franklin was an English chemist and crystallographer. She played a crucial role in the…
Q: 5. The genetic evidence for a triple code (three nucleotides are responsible- for one amino acid)…
A: The proteins are produced from the mRNA by the translation process. This function is performed by…
Q: 3. You find a new site next to your favorite gene through a consensus sequence search. This site has…
A: The two possibilities for what this site may be important for; one in which the function is on the…
Q: 2. The following DNA sequence corresponds to the complete coding sequence of a gene three-amino acid…
A: To obtain the anticodon sequences, we need to convert the complementary DNA sequence to RNA by…
Q: 11. Transcription is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…
A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…
Q: What does it mean for genes to be "conserved"?
A: In this question, we have to explain mean to be genes to be ''conserved ''.
Q: 1.How can we explain the near universal use of the genetic code between bacteria, archaea and…
A: Each and every living organism is made up of DNA and the genetic code is near Universal meaning that…
Q: 2. If instead of 20 amino acids there were 200 amino acids, then how many nucleotides would you be…
A: Answer :- Option (A) is correct. - 3.
Q: 1. how is information from the DNA passes on from one cell to another? 2. How does the structure of…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: WHY DO WE NEED GENETIC ENGINEERING?
A: Genetic engineering is a vast field that mainly involves using rDNA technology to genetically alter…
Q: 4. Evolutionary change due to mutation, resulting from an altered nucleotide sequence (in a cell or…
A: Properties of genetic material Replication, It should be able to generate it's replica It should…
Q: 1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC 5' a. What amino acids are…
A: Non sense codons are stop codons which lead to termination of translation. These are - UAA, UAG,…
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- 3. Compare and contrast the contributions of the following two biologists. What would be the effect on science as a whole if these biologists did not exist? Rosalind Franklin Rosalind Elsie Franklin (25 July 1920 - 16 April 1958) was an English chemist and X- ray crystallographer whose work was central to the understanding of the molecular structures of DNA, RNA, viruses, coal, and graphite. Although her works on coal and viruses were appreciated in her lifetime, her contributions to the discovery of the structure of DNA were largely recognised posthumously. Franklin is best known for her work on the X- ray diffraction images of DNA, particularly Photo 51, which led to the discovery of the DNA double helix for which Francis Crick, James Watson, and Maurice Wilkins shared the Nobel Prize in Physiology or Medicine in 1962. After finishing her work on DNA, Franklin led pioneering work at Birkbeck on the molecular structures of viruses. Her team member Aaron Klug continued her research,…1.How can we explain the near universal use of the genetic code between bacteria, archaea and eukarya? 2. How did scientists crack the genetic code? Describe the experiment in your own words.12
- 5. The genetic evidence for a triple code (three nucleotides are responsible for one amino acid) comes from the following observation: * One or two nucleotide insertions created a mutated virus, while 3 nucleotide insertions had no effect on the virus. Three nucleotide insertions created a mutated virus, while one or two nucleotide insertions had no effect on the virus. Three or four nucleotide insertions created a mutated virus, while one nucleotide insertion had no effect on the virus. One or three nucleotide insertions created a mutated virus, while two nucleotide insertions had no effect on the virus.4. It is known that RNA is a nucleic acid responsible for the synthesis of proteins. However, there is another nucleic acid alongside RNA: DNA. What role does the latter play in relation to RNA? a) RNA is synthesized in the cell in case too large a mutation damages the DNA. b) DNA has the reproductive genetic code of all cells and passes it on to RNA. c) DNA directs the synthesis of enzymes, while RNA synthesizes proteins. d) DNA synthesizes RNA according to a blueprint that includes the guidelines necessary for the structure of proteins.5. You imagine that not all life forms (including viruses and aliens) must have double stranded DNA molecule as their genetic material. Theoretically, a genome can be made of single stranded DNA, single stranded RNA, double stranded DNA, double stranded RNA and a double stranded hybrid of DNA/RNA. Which type of genomes do the following organisms have? a) Genome = 15% G, 0%T, 15%C, 35%U, 35%A b) Genome = 31%G, 19%T, 31%C, 0%U, 19%A
- 8) Which of the following best describes why it is possible for the bacteria to read the instructions in a human gene and produce a human protein as a result? Bacterial cells and human cells are identical and contain the same organelles Bacterial cells and human cells both use DNA to store their genetic information The genetic code is universal - the same codon codes for the same amino acid in all species The bacterial cell already contains a gene that is very similar to the human growth hormone gene1. how is information from the DNA passes on from one cell to another?2. How does the structure of a DNA molecule hellp account for the great variety of life that exists on earth?3. Does your mRNA model more closely resemble the DNA strand from which it was transcribed?4. Explain how the structure of DNA enables the molecule to be easily transcribed. Why it is important for genetic information?5. Why is RNA important to the cell?6. How does the mRNA molecule carry information from DNA?14. Some weed killers, insecticides, and food additives alter the DNA of certain cells. Because of this effect, these substances are known as 1) auxins 2) mutagens 3) meristems 4) autosomes 20. The genetic code of a DNA molecule is determined by a specific sequence of 1) ATP molecules 2) sugar molecules 3) chemical bonds 4) molecular bases 21. What determines the kind of genes an organism possesses? 1) type of amino acids in the cells of the organism 2) sequence of the subunits A, T, C, and G in the DNA of the organism 3) size of simple sugar molecules in the organs of the organism 4) shape of the protein molecules in the organelles of the organism
- 4. Evolutionary change due to mutation, resulting from an altered nucleotide sequence (in a cell or in a virus), is thought to be most rapid in which of the following cases? A. in the case of double-stranded DNA viruses (like the smallpox virus) B. in the case of double-stranded DNA in eubacterial cells C. in the case of single-stranded RNA viruses (like the influenza virus) D. in the case of double-stranded DNA in eukaryotic cells E. in the case of double-stranded DNA in archaeobacterial cells4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two codons in the APP gene sequence are different in the two patients with Alzheimer's disease compared to individuals without the disease. Consider the first codon that's different and complete the table below. Codon in Codon in Amino Acid DNA template strand MRNA APP gene in individuals without Alzheimer's disease APP gene in individuals with Alzheimer's disease Does the change in this codon represent a silent or a missense mutation? Explain.2. What is an exception to the central dogma of molecular biology? a. Viruses sometimes transfer information from RNA to DNA. b. Viruses sometimes transfer information from DNA to RNA. c. Viruses sometimes transfer information from proteins to DNA. d. Viruses can translate without RNA. id ot
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)