the gene where transcription begins, it is said to be at the 5' end of the gene; thus, the promoter region is also called the 5' regulatory region (Figure 8-7a). The first transcribed base is always at the same location, designated the initia- tion site. The promoter is referred to as upstream of the initiation site because it is located ahead of the initiation site (5' of the gene), in the direction opposite the direction of transcription. A downstream site would be located later in the direc- tion of transcription. By convention, the first DNA base to be transcribed is FIGURE 8-6 The MRNA sequence is complementary to the DNA template strand from which it is transcribed and therefore matches the sequence of the nontemplate strand (except that the RNA has U where the DNA has T). This sequence is from the gene for the enzyme B-galactosidase. Sequences of DNA and transcribed RNA Nontemplate strand 5' CTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGATCTGCGCTGC- 3 Coding strand DNA Template strand 3' Noncoding strand GACGGTAACAGTCTGTACATATGGGGCATGCAGAAGGGCTCGCTTTTGCTAGACGCGACG - 5' 5 CUGCCAUUGUCAGACAUGUAUACCCCGUACGUCUUCCCGAGCGAAAACGAUCUGCGCUGC-3' MRNA

the gene where transcription begins, it is said to be at the 5' end of the gene; thus, the promoter region is also called the 5' regulatory region (Figure 8-7a). The first transcribed base is always at the same location, designated the initia- tion site. The promoter is referred to as upstream of the initiation site because it is located ahead of the initiation site (5' of the gene), in the direction opposite the direction of transcription. A downstream site would be located later in the direc- tion of transcription. By convention, the first DNA base to be transcribed is FIGURE 8-6 The MRNA sequence is complementary to the DNA template strand from which it is transcribed and therefore matches the sequence of the nontemplate strand (except that the RNA has U where the DNA has T). This sequence is from the gene for the enzyme B-galactosidase. Sequences of DNA and transcribed RNA Nontemplate strand 5' CTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGATCTGCGCTGC- 3 Coding strand DNA Template strand 3' Noncoding strand GACGGTAACAGTCTGTACATATGGGGCATGCAGAAGGGCTCGCTTTTGCTAGACGCGACG - 5' 5 CUGCCAUUGUCAGACAUGUAUACCCCGUACGUCUUCCCGAGCGAAAACGAUCUGCGCUGC-3' MRNA

Name: In Figure 8-6, describe where the gene promoter islocated. the gene wh
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: In Figure 8-6, describe where the gene promoter islocated. the gene where transcription begins, it is said to be at the 5' end of the gene; thus,the promoter region is also called the 5' regulatory region (Figure 8-7a).The first transcribed base is a

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Related questions

Q: he Drosophila oocyte/embryos A-F show the expression patterns of various mRNAs. Which is the…

A: Fruit flies, or Drosophila melanogaster, have led to significant research as model organisms in…

Q: What are the eight ways gene expression can be regulated? Please summarize each in one-two sentences

A: There must be some sort of regulation on how much mRNA is translated into proteins after the DNA is…

Q: Define recognition sequence.

A: A restriction enzyme or restriction endonuclease is a protein, which can recognize a particular…

Q: Question 11 What is this a diagram of? -35 L (6 bp) (17-19 bp) O Promoter region recognized by…

A: Genes are hereditary units exhibited on the chromosome. They stores genetic information. Genetic…

Q: Consider the two-line model of a gene below: A Y X A Y If the promoter is found to the left of the…

A: Transcription of DNA to RNA is a key step that is part of central dogma of life. Life cannot be…

Q: MRNA transcripts can be collected from cells, made to glow with a fluorescent dye, and added to a…

A: m RNA separated from hepatocytes will bind to those genes present on the microarrays which has its…

Q: Discuss the control of gene expression in eukaryotes. PLEASE KEEP

A: Gene expression is the transcription of gene into mRNA and translation to protein. Gene expression…

Q: Eukaryotes have a multitude of ways of regulating gene expression. Why are all these regulatory…

A: gene regulation is the process used to control the timing, location and amount in which genes are…

Q: enhancer promoter trans-regulatory factor III = III DNA sequences near a gene to regulate its…

A: Gene Regulation : A crucial biological mechanism known as transcriptional regulation enables a…

Q: The first product of genome expression is transcriptome but what happens if the RNA of the genes are…

A: Transcriptome is the collection of the all the RNAs both the coding and non-coding type present in a…

Q: Why is the ErbB family pathway an important pathway for researchers that target cancer therapy.…

A: Numerous human cancers are thought to be caused by aberrant activation of the ErbB family of…

Q: This diagram shows a double-stranded section of DNA. The arrow indicates location and strand of the…

A: Transcription is the process of formation of mRNA using DNA as template. This is possible with the…

Q: There is a situation in which a gene has five exons. Please draw four possible mature products of…

A: Alternative splicing is a biological process that involves the joining of exons from the same gene…

Q: In the fX174 genome, describe the difference between how thegene B and gene A* proteins are made

A: fX174:- Craig venter and his group reported the genome of fX174 in in-vitro conditions. It is a…

Q: GR and PPAR are transcription factors that bind to GRE and PPARE sequences respectively and…

A: A reporter cell line is a stable cell line that has been labeled with a reporter gene, allowing the…

Q: factors in transcription process

A: The process of transcribing a piece of DNA to RNA is known as transcription. Messenger RNA is made…

Q: There are similarities and differences during regulation of gene expression in both prokaryotes and…

A: Gene regulation: It is process in which the expression of the genes gets stop. It occurs when there…

Q: The chart below is a position specific scoring matrix (PSSM, a logarithmic transformed matrix) for a…

A: Hi, Thanks For Your Question. Q2. Answer : The Maximum Score That A Sequence Can Have With This…

Q: In skin cells, a gene is never transcribed. Give two ways this could occur.

A: Transcription is carried out by an enzyme known as RNA polymerase and a group of proteins known as…

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

In Figure 8-6, describe where the gene promoter is
located.

the gene where transcription begins, it is said to be at the 5' end of the gene; thus,
the promoter region is also called the 5' regulatory region (Figure 8-7a).
The first transcribed base is always at the same location, designated the initia-
tion site. The promoter is referred to as upstream of the initiation site because it
is located ahead of the initiation site (5' of the gene), in the direction opposite the
direction of transcription. A downstream site would be located later in the direc-
tion of transcription. By convention, the first DNA base to be transcribed is
FIGURE 8-6 The MRNA sequence is
complementary to the DNA template
strand from which it is transcribed and
therefore matches the sequence of the
nontemplate strand (except that the RNA
has U where the DNA has T). This
sequence is from the gene for the enzyme
B-galactosidase.
Sequences of DNA and transcribed RNA
Nontemplate strand
5'
CTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGATCTGCGCTGC- 3
Coding strand
DNA
Template strand
3'
Noncoding strand
GACGGTAACAGTCTGTACATATGGGGCATGCAGAAGGGCTCGCTTTTGCTAGACGCGACG - 5'
5
CUGCCAUUGUCAGACAUGUAUACCCCGUACGUCUUCCCGAGCGAAAACGAUCUGCGCUGC-3' MRNA

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The Events in Transcription Initiation Describe the sequence of events involved in the initiation of transcription by E. coil RNA polymerase. Include in your description those features a gene must have for proper recognition and transcription by RNA poIymerase.
Transcriptional regulators are proteins that bind to promoters (the 5-flanking regions of genes) to regulate their transcription. Assume that a particular transcription regulator normally promotes transcription of gene X, a transport protein. If a mutation makes this regulator gene nonfunctional, would the resulting phenotype be similar to a mutation in gene X itself? Why or why not?
Substrate Binding by RNA Polymerase RNA polymerase has t binding sites for ribonucleoside triphosphates: the initiation site and the elongation site. The initiation site has a greater Km for NTPs than the elongation site. Suggest what possible significance this fact might have for the control of transcription in cells.
The Lariat Intermediate in RNA Splicing Draw the structures that comprise the lariat branch point formed during mRNA splicing: the invariant A. its 5â€™-R neighbor, its 3â€™-Y neighbor, and its 2â€™-G neighbor.
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
Alternative Splicing Possibilities Suppose exon 17 were deleted from the fast skeletal muscle troponin T gene (Figure 29.46). How many different mRNAs could now be generated by alternative splicing? Suppose that exon 7 in a wild-type troponin T gene were duplicated. How many different mRNAs might be generated from a transcript of this new gene by alternative splicing?
Is an entire chromosome made into an mRNA during transcription?
Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made