The following is the base sequence on the coding strand of a DNA molecule.          AAT GCC AGT GGT TCG CAC   Rewrite the base sequence above and underneath write the base sequence for the template DNA strand. Write the base sequence for the strand of mRNA transcribed from the original strand of DNA or template strand. Remember transcribing means making mRNA from DNA. Write the amino acid sequence translated from this mRNA. Translating means making an amino acid chain from mRNA. A) If the fourth nucleotide in the coding DNA strand was changed from a G to a C, what would be the base sequence of the new strand of mRNA? b) What would the resulting amino acid fragment be? A) If a G were added to the coding DNA strand after the third nucleotide, what would be the base sequence of the resulting mRNA? B) What would the resulting amino acid fragment be?

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Synthesize a Protein Below is a region of a gene. Transcribe the gene into a pre-mRNA strand.…

A: The DNA is the genetic material that is passed from one generation to the next generation. It is…

Q: CGA CUA CCA UCA ACA GUA GGA GGC CCGC AUA CUC CCC UCC ACC GUC 3 CGG GAC AAC UGC GAA CAA GGG CAC AUC…

A: The process of synthesis of proteins with the help of messenger RNA is called translation. Proteins…

Q: you are given a printout of the sense strand of your DNA.  The printout is shown below. The first…

A: Introduction: DNA is a double helix having a sugar-phosphate backbone like a ladder and the base…

Q: 1) Complete the following tables by filling in the DNA sequence, MRNA codons, and the amino acids…

A: The genetic material DNA is converted into RNA and this mRNA codes for a specific protein which is…

Q: Place the steps necessary to perform RNA-Seq in the correct order. Drag the text blocks below into…

A: RNA sequencing, or RNA-Seq, is a powerful tool for analyzing the transcriptome of cells or tissues,…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT

A:

Q: plain the steps of translation. Include all molecules involved in the process and their role in the…

A: Every cell has a nucleus that houses genetic material, DNA.  Genes are the segments of…

Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…

A: Mutation is defined as the change in the nucleotide sequence of DNA.

Q: For the following sequence, transcribe and translate the sequence into a protein. Be sure to…

A: Given strand is DNA template strand- 3'-TACCACCCCCTGAGTGCTGGGATC-5' Transcription of template Strand…

Q: For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid…

A: The given mRNA sequence: AUG ACU AGC UGG GGG UAU UAC UUU UAG  The corresponding DNA sequence will be…

Q: Now imagine that a mutation occurred at the first G in the DNA sequence above and the G became a C.…

A: Hello, thank you for your question, since you have not mentioned the DNA orientation I am answering…

Q: What is the DNA template of the following DNA coding:  ATGGCTAACCTTGTA

A: The DNA template strand is a complementary strand to the DNA coding (sense) strand. It serves as a…

Q: Translate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'):…

A: Translation is a biological process that converts a nucleotide sequence into an amino acid sequence.…

Q: Transcribe and translate the DNA strand below. Remember to use the start and stop sequences.…

A: DNA is converted into mRNA, which contains the instructions needed to make proteins through the…

Q: Transcription and Translation Practice Directions: Read each sequence of DNA and transcribe it to…

A:

Q: Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to…

A: Amino acids are the basic units (monomers) that makeup proteins. They consolidate to frame short…

Q: TAG, TA, and TGA are stop codor

A: 4) The 5' cap is added to the first nucleotide in the transcript during transcription. The cap is a…

Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Transcribe the following DNA molecule into mRNA.  Make sure to find the start codon to begin your…

A: A start codon initiates the transcription while stop codon terminates the transcription process.

Q: The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to…

A: Replication is the process of the formation of identical copies of DNA. It takes place in the…

Q: Original DNA sequence : T A C A C C T T G G C G A C G A C T Amino acid sequence? Mutated DNA…

A: The proteins are produced from the mRNA sequence by translation process that occurs within the…

Q: You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are…

A: Replication is the process by which the DNA generates a copy of itself. Transcription is the process…

Q: Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an…

A: Codons are three nucleotide sequences on an mRNA that code for specific amino acids during the…

Q: Which of the following is matched correctly? DNA helicase: unwinds DNA prior to transcription DNA…

A: The study of molecular biology, which includes biomolecular synthesis, modification, processes, and…

Q: A  partial DNA template has the following sequence of nucleotide bases: A-C-G-T-A-C Type the…

A: DNA or deoxyribonucleic acid is the genetic material in all living organisms that is composed of…

Q: You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.