the encoded protein is substantially shorter than normal, and the amino acid sequence near the end of the protein is different from the amino acid sequence at the same location in the normal protein. What type of point mutation could cause this? Group of answer choices Altered sequence at a splice site Mutation in the promotor Change in the first AUG near the 5’ end of the coding strand Insertion or deletion

Q: put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2.…

A: The translation is the process by which cells make proteins. Here, the mRNA formed by transcription…

Q: What is self-splicing intron? Cite two reasons that suggest cukaryotic spliceosomes originated from…

A: RNA (ribonucleic acid) is the complementary strand of DNA (deoxyribonucleic acid) which is…

Q: 14. Which mutation would be more harmful to a cell? For each predict the outcome of each mutation…

A: In order to base-pair with the correct codon on the mRNA during protein synthesis, the anticodon is…

Q: Match the features to the labeled parts (Some may be used mutliple times, and not all labeled names…

A: Answer. A -  N terminus- A polypeptide synthesis proceeds from N- terminus to C-terminus and…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: 1. For each of the sequences, place an X in the box to indicate the process most immediately…

A: Note: According to the guidelines, we are supposed to answer only one question. Please repost other…

Q: The chemical bisulfite transforms cytosine (C) to uracil (U) (U). In DMSO, bisulfite is dissolved.…

A: Dimethyl sulfoxide is an organosulfur compound with the formula (CH₃)₂SO. The chemical bisulfite…

Q: Nonfunctional HexA protein is responsible for the autosomal recessive disease Tay Sachs. A patient…

A: Ans... a base substitution in an enhancer region

Q: Draw a labelled diagram depicting the flow of genetic information from DNA to mRNA of a eukaryotic…

A: A fundamental principle that describes how genetic information moves throughout a biological system…

Q: (d) Would there be an effect on translation of changing the fourth A in the template strand to a C?…

A: The terms used in the question represents the molecules used during a gene expression. A gene is a…

Q: With respect to an intron, which one of the following options would be a good way to identify the…

A: DNA of eukaryotic genes contain split structures where segments of coding sequences are separated by…

Q: Below is the RNA sequence of a primary transcript. Underline (or highlight) each intron, and then…

A: The primary transcript of RNA sequence contains both introns and exons. Introns are generally spiced…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: Consider which of the five mutations is most likely to cause Duchenne muscular dystrophy in this…

A: Duchenne muscular dystrophy is a disease charecterised by muscular weakness due to lack of a protein…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: In bacteria, since the mRNA does not require any processing to become active, and also since…

A: The cells are the primary unit of life. An organism may be unicellular or multicellular. The…

Q: Which of the following statements about the mechanism of splicing is correct? 1. A mutation in a 5'…

A: The mRNA that is produced by the process of transcription undergoes a modification process in order…

Q: The DNA sequence of the coding strand is shown below; which reading frame most likely codes for a…

A: Start codon in translation is AUG in RNA and ATG in the DNA sequence that codes for methionine amino…

Q: Choose from the following: 5'cap, exon, a site, promoter, p site, intron, AAUAAA, start condon 1.…

A: Transcription is the process by which genetic information encoded in DNA is used to synthesize a…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.

Q: How does the antibiotic streptomycin inhibit bacterial translation? Multiple Choice blocks…

A: Translation Translation involves the answer of information in mrna molecules into the amino acid…

Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…

A: Mutation is in 3rd codon from 3' end. In wild type it codes for histidine while in mutant it codes…

Q: 5' Figure 2 below is a schematic diagram illustrating a short gene with 5000 bp of an unknown…

A: Transcription is defined as a process in which a transcript (RNA) is formed.  It is a unidirectional…

Q: 293T-Splicing Reporter - Spliced Relative Band Intensity 60 55- ** *** ······· 1: :: HeLa-Splicing…

A: The following information discusses the relationship between Splice Reporter mRNA and Relative Band…

Q: How many different single-nucleotide substitutions* (changing one nucleotide to another) in the DNA…

A: The single nucleotide substitutions that can occur to result in a non-sense mutations are -  i) CAA…

Q: start with four exons and show mutually exclusive splicing producing 1-2-4 and 1-3-4 spliced exons.…

A: Mutually exclusive splicing is a phenomenon in which different exons are alternatively spliced,…

Q: Splice sites on mRNAs are located with the help of all of the following EXCEPT:   Question 9…

A: Introns are cut off at splice sites along a pre-mRNA sequence, and exons are connected at these…

Q: mutation 5' 1 3' 5' 3' 5' 3' 4 Mutations in splice sites can lead to the formation of abnormal…

A: Several genetic diseases could also be the results of splice website mutations. as an example,…

Q: In the picture below (representing RNA transcription) match A-E to whether they are 5' or 3' ends. A…

A: The information recorded inside the DNA sequence of one or more genes is transcribed into a strand…

Q: Which of the following concerning progeria are false? Choose all that apply.

A: 1. Regularly, Zmpste24 slices pre-lamin to eliminate 50 amino acids.Zmpste24 is a catalyst engaged…

Q: 25.  A portion of an mRNA attached to a ribosome reads:   5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The translation is a process of Protein synthesis where a copy of mRNA is used as a template strand.…

Q: For each mutant, state what change has occurred in the DNA, whether it was a substitution by…

A: CODONS 3 4 5 6 7 8 9   NORMAL PRO THR VAL THR THR ARG TRP   CODON CCC ACG GUG ACG ACA CGG UGG…

Q: transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the…

A: Since there are multiple questions in this particular question, I'll answer the first three subparts…

Q: The following sequence of DNA is part of the normal, wild-type gene.   5'TAC CGG GAC TTG AGC CGA…

A: A single nucleotide from the DNA is deleted in nucleotide deletion. Although the single nucleotide…

Q: In Figure 16-3a, what is the consequence of the new 5′splice site on the open reading frame? In…

A: A deletion mutation can occur only when a wrinkle forms on the DNA template strand and this further…

Q: Select all the possible mutation types for the following observed phenotype resulting from a…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: If this was an eukaryote, what would you find in the leftmost cytosine? 5' Poly A tail 3' Poly A…

A: IntroductionIn eukaryotic mRNA, there are two important structures that are added to the ends of the…

Q: Which of the following is/are true? 1. Oils are different from fats because they are plant derived…

A: Oils are different from fats because they are plant derived and mostly contain unsaturaded fatty…

Q: protein and find that the encoded protein is substantially longer than normal, with the extra amino…

A: Introduction The mutation is defined as any change or alteration in the sequence of DNA bases,…

Q: The following eukaryotic DNA sequence is a made up gene. It contains a promoter (green), a coding…

A: Most eukaryotic genomes are bigger and more complicated than prokaryotic genomes. Eukaryotic genomes…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: electrostatic dispersion negative C-terminus positive positively negatively N-terminus is…

A: Proteins are biomolecules made up of repeating monomeric units known as "amino acids", the sequence…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.