the code relating DNA to protein.2. Summarize the evidence showing that the sequence ofnucleotides in a gene is colinear with the sequence ofamino acids in a protein.
Q: omplete what is being asked and finally with the Genetic Code table, determine what specific amino…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: the role of DNA ligase I.
A: Answer. DNA ligases are the enzymes that are required by all organisms to sustain the structural…
Q: Maintenance methyltransferases recognize: CG sequences O CC sequences O CA sequences O CT sequences…
A: Question - Maintenance methyltransferases recognize: CG sequences CC sequences CA sequences CT…
Q: Please answer fast List the steps of protein translation. Briefly summarize the mechanisms…
A: Genes include instructions for making proteins. They do not, though, produce proteins directly.…
Q: CDNA contains introns O exons both introns and exons
A: cDNA or complementary DNA is the DNA strand that is synthesized from the spliced mRNA to contain…
Q: Explain the "central dogma" of DNA-protein synthesis and DRAW it, including labels for replication,…
A: Central dogma: The production of proteins from the DNA is known as central dogma. It involves mainly…
Q: Modified True or False: Write TRUE if the statement is correct, if the statement is false, change…
A: There are three options to be read as True and False and are answered and corrected in Step 2
Q: Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein…
A: There are different types of mutations, that result in a change or no change in the protein…
Q: Analyzing: Each nucleotide in a DNA molecule consists of a: * sulfur group, deoxyribose, and a…
A: 1.
Q: 28. Structure of DNA is shown. What are the bonds between 2 nitrogenous bases? A::: P TC A T G A a.…
A: The given diagram represents Watson and Crick model of double helical structure of DNA . DNA helix…
Q: 3. Understand Reverse/forwards strands and reverse complementary strand Example sequence…
A: Transcription is the process by which the nucleotide sequence of the DNA (deoxyribonucleic acid) is…
Q: Explain how the molecular mechanism of DNA polymerase enhances DNA replication.
A: Introduction - The replication of a double-stranded DNA molecule produces two identical DNA…
Q: about transcription a
A: Answer: Depending on the promoter, either strand of DNA can be used as the template strand.The…
Q: e transfer-RNA and the amino acid structure attached to 5' 10
A: In molecular biology and genetics,translation is a process which comes after transcription and in…
Q: Silent Mutations in DNA – Notice one nucleotide pair differs from the normal sequence given in…
A: In silent mutations, a nucleotide change can contribute to no change in the phenotype, i.e., the…
Q: Question: Which of these statements is TRUE if there is 40% Guanine in a strand of DNA? O There is…
A: Calculation of percentage of bases in a DNA According to chargaff's rule, the concentration of…
Q: the two coiled strands in parallel direction to the hydrogen bonds between complementary bases
A: DNA is a double-stranded helix with the two strands held together by hydrogen bonds.
Q: The effect of digestion with DNase I (Deoxyribonuclease I) of the chromatin from a eukaryotic…
A: The cell cycle is a vital process that produces two offspring cells from a single parent cell. DNA…
Q: Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose…
A: Introduction Translation is the process through which a cell uses the genetic information relayed in…
Q: why GC-rich DNA requires a higher temperature to denture or melt than AT-rich DNA and hypothesize as…
A: DNA is genetic material which contains all the information regarding function and development of an…
Q: Match term and its description. heat briefly separate DNA strands |Choose cool to allow primers to…
A: PCR ( polymerase chain reaction ) is a methodology involving synthesis of numerous duplicates or…
Q: The double helix structure of deoxyribonucleic acid (DNA)
A: The characteristic features of an individual is controlled by the genes in DNA. The arrangement of…
Q: Complements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3'…
A: Given information: The sequence of mRNA is as follows: 5' AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG 3'
Q: Describe the structure of DNA. The two strands of DNA are antiparallel. What does the term…
A: DNA contains all organism's order for growth, survival, and reproduction. DNA sequences must be…
Q: 2. Describe the process that is occurring in this image protein nibosome
A: The proteins are the final product of a gene that perform all the functions within the cell.…
Q: Write down the major differences between DNA and RNA.keeping in mind the concept of " central dogma"…
A: The cell possesses genetic material, which acts as a hereditary molecule and controls all functions…
Q: Which statements are true? Explain why or why not.1 Because the DNA double helix is only 2 nm…
A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…
Q: protein synthesis 2 When the DNA sequence TGACT is copied to RNA, the sequence in RNA will be Select…
A: The Central Dogma of Molecular Biology shows that DNA is converted into RNA, which further makes…
Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…
A: DNA replication is a phenomenon in which DNA make itself using Enzyme DNA Polymerase . It occurs in…
Q: DNA Protein Synthesis Test STRUCTURE OF DNA Finish the sentence by choosing the correct answers.…
A: Rosalind Franklin has actually discovered and photographed the helices of the ribonucleic acid and…
Q: Mama: Compare and contrast the major similarities / differences between DNA synthesis on a leading…
A: DNA replication is the process where production of two identical copies of DNA from one original…
Q: рyrim 1. Distinguish between a purine, pyrimidine, hucleoside, nucleotide, polynucleotide, and…
A: INTRODUCTION DNA and RNA are the nucleic acids found in all organisms responsible for the…
Q: Importance of sigma factor within Molecular Biology of Transcription and RNA Processing
A: In this question, we have to describe the importance of sigma factor in molecular biology of…
Q: Describe the base-pair rule. - What three things make up a nucleotide? - What does anti-parallel…
A: 1.Base pair rule: This rule in DNA states that purines (A,G) should bind with pyramidines (T,C) the…
Q: Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein…
A: Introduction A mutation is a modification to the DNA sequence of an organism. Mutations can result…
Q: likely be able to bind a Cyclic AMP DNA binding protein? (only one strand is shown but assume DNA is…
A: CRP is a transcription factor that, when complexed with cAMP, binds DNA and activates transcription…
Q: The sequence of the template strand if a nontemplate strand has the sequence 5 ATGGGGCGC3
A: The coding strand determines the correct nucleotide sequence of mRNA. The template strand acts as a…
Q: These are concerned with the replication and synthesis ofDNA. Write a short essay that distinguishes…
A: Introduction DNA is the genetic material found in most of the species. DNA is composed of chains of…
Q: 17. (comprehension) Refer to the graph to answer the following questions. hobo denie II Sample…
A: We are authorized to answer three subparts at a time, since you have not mentioned which part you…
Q: Evidence that each nucleotide is partof only one codon EXPLAIN
A: Genetic codon is the set of three nucleotides present in the DNA and RNA molecules. The information…
Q: 21. Know how to complete this and similar Tables. DNA т т т mRNA TRNA Amino Acids
A: The given table could be filled up by using the Watson-Crick base pairing rule and the codon table.…
Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…
A: The sense strand is the DNA strand that has the same sequence as mRNA, which uses the antisense…
Q: Different types of mutations and how to use the genetic code table.
A: Mutations are described as the changes that occurs in the sequence of DNA. Mutations can occur from…
Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…
A: A sense strand, also known as a coding strand, is a stretch of double-stranded DNA that carries the…
Q: Can u provide a replication fork structure using deoxyribose, phosphate, guanine, adenine, cytosine,…
A: DNA is a nucleic acid, one of the four significant groups of biological macromolecules.…
Q: How flexible protein domain helps to connect DNA binding domains to activation domains
A: In the polypeptide chain of the protein, the region that stabilizes on its own and folds…
Q: Central Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying…
A: Central dogma means the flow of information occurs from DNA to RNA, and RNA to proteins. Proteins…
the code relating DNA to protein.
2. Summarize the evidence showing that the sequence of
nucleotides in a gene is colinear with the sequence of
amino acids in a protein.
Collinearity defines that a continuous sequence of amino acids is encoded by a continuous sequence of nucleotides. It is a relationship between proteins and gene which is described as the nucleotides in a linear sequence encodes the proteins which contain amino acids in a linear sequence.
Step by step
Solved in 2 steps
- Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly. E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3', 5', C-terminus, and N-terminus.)Please help me discuss this 2 question. Thank you so much. 1. how does pre mRNA is formed in the nucleus and the RNA processing that happen to form a matured RNA. 2. Relate the structure of the three RNA to their function in building of Polypeptide and point out the characteristics of a genetic code and their function in translation.
- 10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence anIn 2 paragraphs. Discuss the differences between RNA and DNA, in terms of structure and function. Identify the difference in the nucleobase of RNA from DNA.Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5 determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the discussion of the entire procedure
- True or False. In a comparison between the DNAs of related organisms such as humans and mice, conserved sequences represent functionally important exons and regulatory regions, and non-conserved sequences generally represent noncoding DNA. Explain your answer in 2-3 sentences.7 Protein structure.Circle one of the three amino acid sequences that is most likely to form a stable a-helix? RASKTARQ DASKTAEQ KPGKPAGQ In one sentence (that can be accompanied by a small picture) explain why?Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.Telomeres are coding repeated DNA sequences at the end of the chromosome. 2. The anticodon sequence AGT can be found in tRNA.
- Give typing answer with explanation and conclusion Which of the following statements regarding the structure and function of tRNA is true? A-The codon / anticodon pairing is absolutely universal among organism. B-The charging of a tRNA does not require energy. C-There are 64 different tRNAs, one for each possible codon. D-Reading 5' to 3', the first base in the anticodon can participate in non Watson and Crick base pairing E- The 3' end of each tRNA has a unique sequence so a specific amino acid can be attached.Using Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.Basis of Comparison DNA RNA 1. Number of strands 2. Location in the cell 3. Type of sugar |4. Nitrogenous base pair Guide Questions: Q1. What are the components of the DNA and RNA molecule?