Explain the "central dogma" of DNA-protein synthesis and DRAW it, including labels for replication, transcription and translation. Understand that the combined processes of transcription and translation are how genes are EXPRESSED Describe the genetic code and how the nucleotide sequence prescribes the amino acid sequence and therefore the protein type.

Q: describe the process of transcription, explaining how DNA, RNA, and RNA polymerase interact to…

A: Genetic information in our cell is carried out from DNA to RNA and then to proteins. These proteins…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: Describe the process of initiation, elongation and termination.

A: * Translation of an mRNA by the ribosome and transcription and replication done in three stages:…

Q: Distinguish between (a) unidirectional and bidirectional synthesis, and (b) continuous and…

A: Answer- DNA replication or synthesis of DNA is the formation of DNA from the parental strand in the…

Q: Explain the process of translation, including location, processes, and molecules involved

A: Replication, transcription, and translation are the basic process in the molecular dogma of the…

Q: State the function of histones in DNA packaging.

A: Histones are highly basic proteins because they are rich in lysine and arginine residues. They are…

Q: Name the two phases of protein synthesis and describe the roles of DNA, mRNA, tRNA, and rRNA in each…

A: Proteins can be defined as the type of macromolecules which is formed by the amino acid. The amino…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: Explain how DNA transcription occurs and what is formed by this process.

A: The central dogma of molecular biology, given by Dr. Francis Crick states that the information…

Q: Consider which of the five mutations is most likely to cause Duchenne muscular dystrophy in this…

A: Duchenne muscular dystrophy is a disease charecterised by muscular weakness due to lack of a protein…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: Explain Leading-strand and lagging-strand DNA synthesis.

A: During the process of normal replication 1. As compared to leading strand synthesis, lagging strand…

Q: Describe the structure and replication of the genetic material and basic aspects of the flow of…

A: The genetic material passes from one generation to another, i.e., from parents to offspring, and…

Q: Determine what amino acid will be formed from the given DNA strand below:…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: Explain the effect(s) the following scenarios would have on DNA replication or translation. For each…

A: Replication describes how cells continue to divide after they have completed the process of cell…

Q: Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is…

A: Proteins are important for the normal functioning of the human body. Proteins are made of amino…

Q: How to transfer biological information in protein synthesis? What is the link between DNA and…

A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…

Q: Describe two ways by which DNA is released from cells.

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: Give 7 examples where a specific nucleotide sequences/elements are recognized by protein or…

A: Replication is the process by which new strands of DNA are synthesized from pre-existing DNA.…

Q: Describe the process of translation of DNA to RNA.

A: DNA is the genetic materials of us.

Q: Define Genome, Transcriptome, and  Proteome. Include examples of each one and a very detailed…

A: Rapid advancements in science and technology have enabled various scientists and others to research…

Q: What factors ensure accuracy in protein synthesis? How does the level of accuracy usually attained…

A: Replication:  It is a process of synthesis of a new DNA strand from the previously existing one.…

Q: Describe the composition and structure of the nucleosome.

A: A cell is the fundamental unit of life. All living organisms are made up of one or many cells. The…

Q: describe the process of lysosomal hydrolase arriving to the lysosome. without including translation

A: The targetting of lysosomal enzyme depends on GERL system. Lysosome, Golgi bodies, endoplasmic…

Q: IN A BOND PAPER OR ANY PAPER. CREATE AN INTERACTIVE POSTER ENTITLED "THE CENTRAL DOGMA OF LIFE"…

A: Central dogma of life is defined as a pattern of information about the flow of genetic information…

Q: State the function of histones in DNA packaging.

A: Introduction In this question we have to state the function of histones in DNA packaging.

Q: Describe the movement of the open complex along the DNA.

A: The open complex is used in the process of transcription when the DNA template is used to produce…

Q: Explain the steps in DNA Translation

A: The translation is the decoding of the genetic code found within a messenger RNA (mRNA) molecule to…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.