The code for a fully functional protein is actually coming from an mRNA transcript that has undergone post transcriptional processing which is essentially way too different from the original code in the DNA template.  Given:    Protein with known amino acid sequence Requirement:   Original DNA code (itemize the steps you would take to get to know the original DNA code of the protein in focus)

Q: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST…

A: Amino acyl tRNA synthase functions to join appropriate amino acids with their corresponding tRNA.…

Q: Discuss the two steps involved in RNA processing. Please explain each step in 2-3 sentences only.

A: In Eukaryote, mRNA produced during the transcription process is known as pre-mRNA. They undergo…

Q: Which of the following statements regarding "start" and "stop" signals apply to both transcription…

A: Introduction  The process of synthesising RNA from a DNA template, known as transcription, converts…

Q: you are given a printout of the sense strand of your DNA.  The printout is shown below. The first…

A: Introduction: DNA is a double helix having a sugar-phosphate backbone like a ladder and the base…

Q: describe a scenario (as you would to a 12th grader) a physiological situation (protein need) that…

A: CENTRAL DOGMA-  Replication is the process when DNA replicates itself means it will make copies of…

Q: describe the process of reading a gene and turning it into a protein in a eukaryote.Your first…

A: Transcription: The process of conversion of segment of the DNA to RNA is called as Transcription.…

Q: The following double stranded segment of DNA is part of a protein coding gene. The segments in…

A:

Q: plain the steps of translation. Include all molecules involved in the process and their role in the…

A: Every cell has a nucleus that houses genetic material, DNA.  Genes are the segments of…

Q: In automated sequencing, you are given a printout of the sense strand of your DNA.  The printout is…

A: a - To determine Reading Frame Sequence: Every protein starts with a Methionine. It is because start…

Q: In automated sequencing, you are given a printout of the sense strand of your DNA.  The printout is…

A: Introduction Nucleic Acids:- Nucleic acids are biopolymers, macromolecules, essential to all known…

Q: True or False: When determining the transcription start site, there is a nucleotide position…

A: Question - True or False : When determining the transcription start site , there is a nucleotide…

Q: Transcription and Translation Practice Directions: Read each sequence of DNA and transcribe it to…

A:

Q: Where and for what reason (s) are you likely to observe the letter "N" in your Sanger sequence…

A: Sanger sequencing, also known as chain-termination sequencing, is a method for determining the…

Q: mutant appear on a gel in comparison

A: Point mutations can cause serious changes to an organism if they change the way a protein works By…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: Protein synthesis or translation process involve at least three steps- In the first step there is a…

Q: Listed below are steps in the transcription process.  Reorganize the list so the steps in the…

A: Correct steps of Transcription are as follows.   1. General Transcription factors bind TATA box…

Q: ess(es) are they involved in (for example, r VOU drow it (otiolk figuro)? figurel

A: The gene is one of the units of the genetic material. The genetic material is studied at various…

Q: Briefly explain the importance of the protein factor EF-Ts in the translation process. Do not simply…

A: The process of translation in involves three steps - (A) Initiation: it involves binding of a small…

Q: Match each aspect of transcription or translation

A: Central Dogma of Molecular Biology:It is a foundational principle that describes the flow of…

Q: Indicate whether there is matching (1) or base complementarity (2) between the following nucleic…

A: The template strand is also called antisense strand.  Biosynthesis of mRNA using antisense strand of…

Q: The following gene sequence of nucleotides is found on the template (non-coding) strand of a…

A: The sequence would be opposite to template strand and similar to coding strand(except the thiamine…

Q: F10 (PC) or ALT+FN+F10 (Mac). Paragraph Arial 14px

A: Central dogma is the process in which DNA is transcribed in to mRNA is called transcription and mRNA…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Imagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow…

A: Exons are coding sequences and introns are the non-coding sequences. Splicing is the process of…

Q: A protein has the following amino acid sequence:…

A: The process of translation requires transfer of genetic information from a polymer of nucleotides to…

Q: From the results of your BLAST search you can link to the GENE entry for one of your top hits. This…

A: I do not have access to the specific BLAST results you are referring to. However, I can provide…

Q: Please draw the mature mRNA (before it is ready to be exported from nucleus):

A: In addition to their role in genetic information storage and transmission, nucleic acids are also…

Q: How does polio (poliovirus) get more than one protein from a single mRNA? Give typing answer with…

A: Polio is an life threatening disease that affects the brain stem or spinal cord and results in…

Q: peptide bonds between adjacent amino acids requires peptidyl transferase enzyme activity, which is…

A: The enzymatic activity of ribosome is called as peptidyl transferase activity. The site of catalysis…

Q: Which of the following statements regarding "start" and "stop" signals apply to both transcription…

A: Introduction  A two-step technique is used to express the genes that code for proteins. A gene's DNA…

Q: During the transcription elongation step, an internal structure in the RNA Polymerase called…

A: Question - During the transcription elongation step, an internal structure in the RNA Polymerase…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: Which of the following mutations would be most likely to have the most negative effect on the…

A: Translation is the process of synthesis of protein in the cytoplasm.

Q: Match the term to its best definition. molecule with high-energy bond that carries amino acid to…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis…

Q: Draw a eukaryotic mRNA that has been fully processed. Label the key parts including the Kozak…

A: The eukaryotic RNA is formed from the eukaryotic DNA by the process of transcription.