The antiparallel nature of DNA ensures that identical RNA transcripts will be produced regardless ofwhich strand of DNA is used as the template, so long as the transcript is synthesized 5' to 3'.TrueFalse

DNA is deoxy ribo nucleic acid and consist of two strands that wind around each other like a twisted…

Answered: The antiparallel nature of DNA ensures…

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 4SQ

See similar textbooks

Similar questions

None
Provide the complementary strand and the RNA transcription product for the following DNA template segment:5'-AGGGGCCGTTATCGTT-3'
True or false double strand rna is synthesized using taq polymerase. plasmids are linear dna moley in a eukaryotic cell dna is packaged into exosomes. Decreasing the concentration of agarose in a gel will allow better separation of smaller fragments of dna
DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence 5’-CCG ATC GCA CAA-3’ Using this sequence as template after transcription no protein can be translated. Why? Presence of start codon Absence of start codon Due to mutation If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)? Substitution of C with G No change4 Deletion of Both I & III
The palm domain of a DNA polymerase O contains the catalytic site of the enzyme CIC Site
. Explain why the following statement is true: RNA polymerase copies template DNA in the 3’ to 5’ direction.
sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA template sequence 5’-TAT-GGC-ATG-3’? Ile-Arg-Pro His-Ala-Ile Tyr-Gly-Met Val-Arg-Tyr Ile-Pro-Tyr
dna stored at physiological ph is negative charge single strand positive charge unchanged degraded
using the genetic code provided what would be the corresponding polypeptide sequence for the DNA template sequence 5’-TAT-GGC-ATG-3’? Ile-Arg-Pro His-Ala-Ile Tyr-Gly-Met Val-Arg-Tyr Ile-Pro-Tyr
DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence5’-CCG ATC GCA CAA-3’a) Using this sequence as template after transcription no protein can be translated. Why? I. Presence of start codonII. Absence of start codonIII. Due to mutationb) If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)?I. Substitution of C with GII. No changeIII. Deletion of CIV. Both I & III
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.
Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5’-3’.

SEE MORE QUESTIONS

Recommended textbooks for you

Human Biology (MindTap Course List)

Biology

ISBN:

9781305112100

Author:

Cecie Starr, Beverly McMillan

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Human Biology (MindTap Course List)

Biology

ISBN:

9781305112100

Author:

Cecie Starr, Beverly McMillan

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS

The antiparallel nature of DNA ensures that identical RNA transcripts will be produced regardless of which strand of DNA is used as the template, so long as the transcript is synthesized 5' to 3'. True False