Scenario 1: Dyskeratosis congenita (DKC) is a rare human genetic disorder affecting telomere replication. Mutations in the genes encoding telomerase enzymes result in telomeres with RNA subunits that do not read 3'-CAACCCCAAC-5'. DKC symptoms include bone marrow failure (reduced production of blood cells) and anemia. If symptoms are severe, a bone marrow transplant may be the only form of effective treatment. Question 4: To explain how mutations in genes encoding telomerase RNA subunits could lead to bone marrow failure, answer the two questions below. I am only expecting single sentence answers for this question. A. When an RNA subunit on telomerase does not function, what happens to the length of the chromosome over time? B. Why might this mutation be more of a problem in rapidly dividing cells like hematopoietic stem cells?

Q: Describe the role of mismatch repair (MMR) in DNA repair.Why do mutations in MMR proteins increase…

A: DNA mismatch repair is a system for recognizing and repairing erroneous insertion, deletion, and…

Q: Match the following Characteristic to their proper Mutation:   Question 4 options:  CHOICES: 1.…

A: Mutations change the sequence of nucleotide bases and hence results in phenotypic and genotypic…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: 1. Differentiate the genotype and phenotype of a cell. 2. If deoxyribonucleotides that lack the…

A: In an organism the genetic matter is present inside the genes present in the chromosome of the…

Q: . List the sequences of RNA that would be transcribed template sequences. a. Ans:…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: Explain the connection between defects in DNA repair systemsand the inherited human disease…

A: Genetic disorder It is also called as inherited disorder and is caused due to, Chromosomal…

Q: Describe in detail three spontaneous lesions that can lead to mutations. Give examples.

A: Three spontaneous lesions are depurination, deamination, and transversions. 1. Depurination occurs…

Q: Why would aquatic microbes need maximal surface area?

A: In the living world, we see a large number of microorganisms, animals and plants. These organisms…

Q: le) Frrors may occur during DNA replication, resulting in a change to the sequence of base triplets.…

A: Through the replication process, the information from one DNA molecule is replicated to create two…

Q: 7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: Sickle cell anemia occurs due to a point mutation in a gene for hemoglobin protein. This mutation…

A: Sickle cell anemia occurs due to point mutation in a gene for hemoglobin. Its symptoms are - fatigue…

Q: Please read the scenario below and then answer the question (in bold) that follows. An original DNA…

A: The original DNA sequence is  3'-GGCGCTAGAATC-5'. A mutated version of that DNA strand is…

Q: Consider which of the five mutations is most likely to cause Duchenne muscular dystrophy in this…

A: Duchenne muscular dystrophy is a disease charecterised by muscular weakness due to lack of a protein…

Q: Use the description of the FGFR3 and your knowledge of protein synthesis to explain how this…

A: FGFR3 stands for fibroblast growth factor receptor 3. It is found in the cell's membrane and sense…

Q: III. DOUBLE MATCHING TYPE choose the enzyme/protein/requirement in Column A, and the…

A:

Q: Smoking status is a known risk factor for lung cancer development. Researchers are conducting a…

A:

Q: Dr. Serena Velazquez lands a coveted post-doc position at Johns Hopkins following completion of her…

A: The study of cancer therapeutics is an important area of research in the field of oncology. With the…

Q: Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example…

A: In transcription only a segment of DNA and only one of the strand is copied into RNA.

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA…

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate…

Q: You have a patient slated to undergo somatic cell gene therapy to alleviate a cystic fibrosis…

A: Answer: Cystic fibrosis is the result of homozygous recessive mutations in the CFTR gene.

Q: 1)  Dr. Velazquez considers targeted mutagenesis of DNA ligase. What would that do?   a)  Prevent…

A: INTRODUCTION DNA ligase DNA ligase is an enzyme that can join DNA fragments by catalyzing the…

Q: Which of the following statements are correct about DNA Repair in mammals (select all that apply)?…

A: DNA mutation is a process by which DNA damages are repaired by various enzymes. If these DNA damages…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: 1) Explain why the process of DNA replication is slower on the lagging strand than on the leading…

A: DNA replication is a process in which from one Duplex DNA ,two identical copies of DNA is…

Q: 2b) Suppose you generated a mutant E. coli strain in which it was DNA Polymerase I that was…

A: "DNA polymerases are enzymes that catalyse DNA synthesis during replication." The primary function…

Q: True or false? The most common form of Down's Syndrome results from a spontaneous, somatic, gene…

A: A syndrome is a set of symptoms or characteristics that tend to occur together and indicate the…

Q: Which of the given disorder can be seen in an individual when the mutation includes substitution of…

A: Purines and pyrimidines are nitrogenous bases present in nucleic acids. Substitution of purine by…

Q: 1. Determine the approximate number of amino acids that would be missing in the telomerase protein…

A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…

Q: Mutagens, when introduced to the body can always cause cancer. Is this statement true? Select the…

A: Any agent that can cause mutation in the genetic material are called as the mutagen. Mutagen may be…

Q: Recognize the impact of DNA mutations.   Summarize the process of genetic translation.

A: The mutation is the change in the sequence of the coding genes. This can happen during DNA…

Q: Identify the best match between the mutation description and term.   a. Transversion: results in a…

A: Often mutation occurs in our body. These mutations can be beneficial or lethal. The mutation occurs…

Q: 3). Explain a substitution mutation 4) Explain a deletion mutation 5). Explain an insertion…

A: 3. Substitution mutation: change of a single base causes change of the amino acid.

Tissue regeneration & repair

Tissue regeneration involves the restoration of tissue components by regrowth of damaged tissues. In contrast, tissue repair involves patching of injured tissue rather than restoring it. It is the proliferative capacity of the cells that decides the amount of regeneration against the repair that would occur in the tissue. Both regeneration and repair depending on the duration of the injury and response to the inflammation.